Exosome Component 9 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52049-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Exosome Component 9 Reagents
CRO Services
Product recommended

All Exosome Component 9 Reagents
Exosome Component 9 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1317 bp
Description
Full length Clone DNA of Mouse exosome component 9 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Exosome Component 9 cDNA ORF Clone, Mouse, N-His tag Alternative Names
p5 cDNA ORF Clone, Mouse;p6 cDNA ORF Clone, Mouse;PM/Scl-75 cDNA ORF Clone, Mouse;Pmscl1 cDNA ORF Clone, Mouse;RRP45 cDNA ORF Clone, Mouse
Exosome Component 9 Background Information
Full Name
exosome component 9

Exosome Component 9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Exosome Component 9 cDNA ORF Clone in Cloning Vector, Mouse MG52049-G
Exosome Component 9 cDNA ORF Clone, Mouse, untagged MG52049-UT
Exosome Component 9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52049-ACGLN
Exosome Component 9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52049-ACG
Exosome Component 9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52049-ANG
Exosome Component 9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52049-ACR
Exosome Component 9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52049-ANR
Exosome Component 9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52049-CF
Exosome Component 9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52049-NF
Exosome Component 9 cDNA ORF Clone, Mouse, C-His tag MG52049-CH
Exosome Component 9 cDNA ORF Clone, Mouse, C-HA tag MG52049-CY
Exosome Component 9 cDNA ORF Clone, Mouse, N-HA tag MG52049-NY
Exosome Component 9 cDNA ORF Clone, Mouse, C-Myc tag MG52049-CM
Exosome Component 9 cDNA ORF Clone, Mouse, N-Myc tag MG52049-NM
Exosome Component 9 qPCR Primer Pairs, Mouse MP201922

Exosome Component 9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Exosome Component 9 cDNA ORF Clone in Cloning Vector, Human HG16863-U
Exosome Component 9 cDNA ORF Clone, Human, untagged HG16863-UT
Exosome Component 9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16863-ACG
Exosome Component 9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16863-ACGLN
Exosome Component 9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16863-ANG
Exosome Component 9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16863-ACR
Exosome Component 9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16863-ANR
Exosome Component 9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16863-CF
Exosome Component 9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16863-NF
Exosome Component 9 cDNA ORF Clone, Human, C-His tag HG16863-CH
Exosome Component 9 cDNA ORF Clone, Human, N-His tag HG16863-NH
Exosome Component 9 cDNA ORF Clone, Human, C-HA tag HG16863-CY
Exosome Component 9 cDNA ORF Clone, Human, N-HA tag HG16863-NY
Exosome Component 9 cDNA ORF Clone, Human, C-Myc tag HG16863-CM
Exosome Component 9 cDNA ORF Clone, Human, N-Myc tag HG16863-NM
info info
添加购物车成功! 添加购物车失败!