EXOSC4 cDNA ORF Clone, Mouse, untagged

Cat: MG52491-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EXOSC4 Reagents
CRO Services
Product recommended

All EXOSC4 Reagents
EXOSC4 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Mouse exosome component 4.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EXOSC4 cDNA ORF Clone, Mouse, untagged Alternative Names
1110039I09Rik cDNA ORF Clone, Mouse;1500001N04Rik cDNA ORF Clone, Mouse;Rrp41 cDNA ORF Clone, Mouse
EXOSC4 Background Information
Full Name
exosome component 4

EXOSC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EXOSC4 cDNA ORF Clone in Cloning Vector, Mouse MG52491-U
EXOSC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52491-ACGLN
EXOSC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52491-ACG
EXOSC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52491-ANG
EXOSC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52491-ACR
EXOSC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52491-ANR
EXOSC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52491-CF
EXOSC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52491-NF
EXOSC4 cDNA ORF Clone, Mouse, C-His tag MG52491-CH
EXOSC4 cDNA ORF Clone, Mouse, N-His tag MG52491-NH
EXOSC4 cDNA ORF Clone, Mouse, C-HA tag MG52491-CY
EXOSC4 cDNA ORF Clone, Mouse, N-HA tag MG52491-NY
EXOSC4 cDNA ORF Clone, Mouse, C-Myc tag MG52491-CM
EXOSC4 cDNA ORF Clone, Mouse, N-Myc tag MG52491-NM
EXOSC4 qPCR Primer Pairs, Mouse MP202364

EXOSC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EXOSC4 cDNA ORF Clone in Cloning Vector, Human HG16973-U
EXOSC4 cDNA ORF Clone, Human, untagged HG16973-UT
EXOSC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16973-ACG
EXOSC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16973-ACGLN
EXOSC4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16973-ANG
EXOSC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16973-ACR
EXOSC4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16973-ANR
EXOSC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16973-CF
EXOSC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16973-NF
EXOSC4 cDNA ORF Clone, Human, C-His tag HG16973-CH
EXOSC4 cDNA ORF Clone, Human, N-His tag HG16973-NH
EXOSC4 cDNA ORF Clone, Human, C-HA tag HG16973-CY
EXOSC4 cDNA ORF Clone, Human, N-HA tag HG16973-NY
EXOSC4 cDNA ORF Clone, Human, C-Myc tag HG16973-CM
EXOSC4 cDNA ORF Clone, Human, N-Myc tag HG16973-NM
info info
添加购物车成功! 添加购物车失败!