EVI2A cDNA ORF Clone, Mouse, N-His tag

Cat: MG52074-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EVI2A Reagents
CRO Services
Product recommended

All EVI2A Reagents
EVI2A cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Mouse ecotropic viral integration site 2a with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EVI2A cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW491894 cDNA ORF Clone, Mouse;Evi-2 cDNA ORF Clone, Mouse;Evi2 cDNA ORF Clone, Mouse
EVI2A Background Information
Full Name
ecotropic viral integration site 2A

EVI2A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EVI2A cDNA ORF Clone in Cloning Vector, Mouse MG52074-G
EVI2A cDNA ORF Clone, Mouse, untagged MG52074-UT
EVI2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52074-ACGLN
EVI2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52074-ACG
EVI2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52074-ACR
EVI2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52074-CF
EVI2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52074-NF
EVI2A cDNA ORF Clone, Mouse, C-His tag MG52074-CH
EVI2A cDNA ORF Clone, Mouse, C-HA tag MG52074-CY
EVI2A cDNA ORF Clone, Mouse, N-HA tag MG52074-NY
EVI2A cDNA ORF Clone, Mouse, C-Myc tag MG52074-CM
EVI2A cDNA ORF Clone, Mouse, N-Myc tag MG52074-NM
EVI2A qPCR Primer Pairs, Mouse MP201947

EVI2A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EVI2A cDNA ORF Clone in Cloning Vector, Human HG15460-G
EVI2A cDNA ORF Clone, Human, untagged HG15460-UT
EVI2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15460-ACGLN
EVI2A cDNA ORF Clone, Human, C-GFPSpark® tag HG15460-ACG
EVI2A cDNA ORF Clone, Human, C-OFPSpark® tag HG15460-ACR
EVI2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15460-CF
EVI2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15460-NF
EVI2A cDNA ORF Clone, Human, C-His tag HG15460-CH
EVI2A cDNA ORF Clone, Human, N-His tag HG15460-NH
EVI2A cDNA ORF Clone, Human, C-HA tag HG15460-CY
EVI2A cDNA ORF Clone, Human, N-HA tag HG15460-NY
EVI2A cDNA ORF Clone, Human, C-Myc tag HG15460-CM
EVI2A cDNA ORF Clone, Human, N-Myc tag HG15460-NM
EVI2A qPCR Primer Pairs, Human HP104084
info info
添加购物车成功! 添加购物车失败!