AGXT2L1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52622-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGXT2L1 Reagents
CRO Services
Product recommended

All AGXT2L1 Reagents
AGXT2L1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1500 bp
Description
Full length Clone DNA of Mouse ethanolamine phosphate phospholyase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGXT2L1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1300019H02Rik cDNA ORF Clone, Mouse;Agxt2l1 cDNA ORF Clone, Mouse;AI195447 cDNA ORF Clone, Mouse
AGXT2L1 Background Information
Full Name
ethanolamine-phosphate phospho-lyase

AGXT2L1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
AGXT2L1 cDNA ORF Clone in Cloning Vector, Rhesus CG90685-G
AGXT2L1 cDNA ORF Clone, Rhesus, untagged CG90685-UT
AGXT2L1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90685-ACG
AGXT2L1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90685-ANG
AGXT2L1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90685-ACR
AGXT2L1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90685-ANR
AGXT2L1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90685-CF
AGXT2L1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90685-NF
AGXT2L1 cDNA ORF Clone, Rhesus, C-His tag CG90685-CH
AGXT2L1 cDNA ORF Clone, Rhesus, N-His tag CG90685-NH
AGXT2L1 cDNA ORF Clone, Rhesus, C-HA tag CG90685-CY
AGXT2L1 cDNA ORF Clone, Rhesus, N-HA tag CG90685-NY
AGXT2L1 cDNA ORF Clone, Rhesus, C-Myc tag CG90685-CM
AGXT2L1 cDNA ORF Clone, Rhesus, N-Myc tag CG90685-NM

AGXT2L1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGXT2L1 cDNA ORF Clone in Cloning Vector, Mouse MG52622-G
AGXT2L1 cDNA ORF Clone, Mouse, untagged MG52622-UT
AGXT2L1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52622-ACGLN
AGXT2L1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52622-ACG
AGXT2L1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52622-ANG
AGXT2L1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52622-ACR
AGXT2L1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52622-ANR
AGXT2L1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52622-CF
AGXT2L1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52622-NF
AGXT2L1 cDNA ORF Clone, Mouse, C-His tag MG52622-CH
AGXT2L1 cDNA ORF Clone, Mouse, C-HA tag MG52622-CY
AGXT2L1 cDNA ORF Clone, Mouse, N-HA tag MG52622-NY
AGXT2L1 cDNA ORF Clone, Mouse, C-Myc tag MG52622-CM
AGXT2L1 cDNA ORF Clone, Mouse, N-Myc tag MG52622-NM
AGXT2L1 qPCR Primer Pairs, Mouse MP202493
info info
添加购物车成功! 添加购物车失败!