C2orf30 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52559-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C2orf30 Reagents
CRO Services
Product recommended

All C2orf30 Reagents
C2orf30 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1452 bp
Description
Full length Clone DNA of Mouse endoplasmic reticulum lectin 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C2orf30 cDNA ORF Clone, Mouse, N-His tag Alternative Names
4933407N01Rik cDNA ORF Clone, Mouse
C2orf30 Background Information
Full Name
endoplasmic reticulum lectin 1

C2orf30 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
C2orf30 cDNA ORF Clone in Cloning Vector, Rat RG8A4620-U
C2orf30 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4620-ACGLN

C2orf30 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C2orf30 cDNA ORF Clone in Cloning Vector, Mouse MG52559-G
C2orf30 cDNA ORF Clone, Mouse, untagged MG52559-UT
C2orf30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52559-ACGLN
C2orf30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52559-ACG
C2orf30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52559-ACR
C2orf30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52559-CF
C2orf30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52559-NF
C2orf30 cDNA ORF Clone, Mouse, C-His tag MG52559-CH
C2orf30 cDNA ORF Clone, Mouse, C-HA tag MG52559-CY
C2orf30 cDNA ORF Clone, Mouse, N-HA tag MG52559-NY
C2orf30 cDNA ORF Clone, Mouse, C-Myc tag MG52559-CM
C2orf30 cDNA ORF Clone, Mouse, N-Myc tag MG52559-NM
C2orf30 qPCR Primer Pairs, Mouse MP202432

C2orf30 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C2orf30 cDNA ORF Clone in Cloning Vector, Human HG13568-G
C2orf30 cDNA ORF Clone, Human, untagged HG13568-UT
C2orf30 cDNA ORF Clone, Human, C-GFPSpark® tag HG13568-ACG
C2orf30 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13568-ACGLN
C2orf30 cDNA ORF Clone, Human, C-OFPSpark® tag HG13568-ACR
C2orf30 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13568-CF
C2orf30 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13568-NF
C2orf30 cDNA ORF Clone, Human, C-His tag HG13568-CH
C2orf30 cDNA ORF Clone, Human, N-His tag HG13568-NH
C2orf30 cDNA ORF Clone, Human, C-HA tag HG13568-CY
C2orf30 cDNA ORF Clone, Human, N-HA tag HG13568-NY
C2orf30 cDNA ORF Clone, Human, C-Myc tag HG13568-CM
C2orf30 cDNA ORF Clone, Human, N-Myc tag HG13568-NM
C2orf30 qPCR Primer Pairs, Human HP102254
info info
添加购物车成功! 添加购物车失败!