EphB4 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50582-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EphB4 Reagents
CRO Services
Product recommended

All EphB4 Reagents
EphB4 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3006 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 861A/G,1077A/T,2565T/C,2718T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse Eph receptor B4 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
HindIII + XbaI(6kb+3.01kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EphB4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB4 cDNA ORF Clone, Mouse, C-HA tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5622
EphB4 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AI042935 cDNA ORF Clone, Mouse;Htk cDNA ORF Clone, Mouse;MDK2 cDNA ORF Clone, Mouse;Myk1 cDNA ORF Clone, Mouse;Tyro11 cDNA ORF Clone, Mouse
EphB4 Background Information

Ephrin type-B receptor 4 is a protein that in humans is encoded by the EPHB4 gene. It is a single-pass type I membrane protein belonging to the ephrin receptor subfamily of protein kinase superfamily. Members of the ephrin and Eph family are local mediators of cell function through largely contact-dependent processes in development and in maturity. Furthermore, EphB4 protein and the corresponding ligand Ephrin-B2 contribute to tumor growth in various human tumors. EphB4 protein has tumor suppressor activities and that regulation of cell proliferation, extracellular matrix remodeling, and invasive potential are important mechanisms of tumor suppression. Therefore, Ephrin-B2/EphB4 may be recognized as a novel prognostic indicator for cancers.

Full Name
EPH receptor B4
References
  • Davalos V, et al. (2006) EPHB4 and survival of colorectal cancer patients. Cancer Res. 66(18): 8943-8.
  • Zhao C, et al. (2006) Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab. 4(2): 111-21.
  • Kertesz N, et al. (2006) The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth. Blood. 107(6): 2330-8.
  • Noren NK, et al. (2007) Paradoxes of the EphB4 receptor in cancer. Cancer Res. 67(9): 3994-7.
  • Taylor AC, et al. (2007) EphB4 expression along adult rat microvascular networks: EphB4 is more than a venous specific marker. Microcirculation. 14(3): 253-67.
  • EphB4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphB4 cDNA ORF Clone in Cloning Vector, Mouse MG50582-M
    EphB4 cDNA ORF Clone, Mouse, untagged MG50582-UT
    EphB4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50582-ACG
    EphB4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50582-ACGLN
    EphB4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50582-ACR
    EphB4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50582-CF
    EphB4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50582-NF
    EphB4 cDNA ORF Clone, Mouse, C-His tag MG50582-CH
    EphB4 cDNA ORF Clone, Mouse, N-His tag MG50582-NH
    EphB4 cDNA ORF Clone, Mouse, N-HA tag MG50582-NY
    EphB4 cDNA ORF Clone, Mouse, C-Myc tag MG50582-CM
    EphB4 cDNA ORF Clone, Mouse, N-Myc tag MG50582-NM
    EphB4 qPCR Primer Pairs, Mouse MP200574

    EphB4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphB4 cDNA ORF Clone in Cloning Vector, Human HG10235-M
    EphB4 cDNA ORF Clone, Human, untagged HG10235-UT
    EphB4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10235-ACGLN
    EphB4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10235-ACG
    EphB4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10235-ACR
    EphB4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10235-CF
    EphB4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10235-NF
    EphB4 cDNA ORF Clone, Human, C-His tag HG10235-CH
    EphB4 cDNA ORF Clone, Human, N-His tag HG10235-NH
    EphB4 cDNA ORF Clone, Human, C-HA tag HG10235-CY
    EphB4 cDNA ORF Clone, Human, N-HA tag HG10235-NY
    EphB4 cDNA ORF Clone, Human, C-Myc tag HG10235-CM
    EphB4 cDNA ORF Clone, Human, N-Myc tag HG10235-NM
    EphB4 qPCR Primer Pairs, Human HP100066
    info info
    添加购物车成功! 添加购物车失败!