After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EPHB4 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse EPHB4 cDNA Clone Product Information
NCBI RefSeq:NM_010144.6
RefSeq ORF Size:2964bp
cDNA Description:Full length Clone DNA of Mus musculus Eph receptor B4 with C terminal Myc tag.
Gene Synonym:Htk, MDK2, Myk1, Tyro11, AI042935, Ephb4
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ephrin type-B receptor 4 is a protein that in humans is encoded by the EPHB4 gene. It is a single-pass type I membrane protein belonging to the ephrin receptor subfamily of protein kinase superfamily. Members of the ephrin and Eph family are local mediators of cell function through largely contact-dependent processes in development and in maturity. Furthermore, EphB4 protein and the corresponding ligand Ephrin-B2 contribute to tumor growth in various human tumors. EphB4 protein has tumor suppressor activities and that regulation of cell proliferation, extracellular matrix remodeling, and invasive potential are important mechanisms of tumor suppression. Therefore, Ephrin-B2/EphB4 may be recognized as a novel prognostic indicator for cancers.

References
  • Davalos V, et al. (2006) EPHB4 and survival of colorectal cancer patients. Cancer Res. 66(18): 8943-8.
  • Zhao C, et al. (2006) Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab. 4(2): 111-21.
  • Kertesz N, et al. (2006) The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth. Blood. 107(6): 2330-8.
  • Noren NK, et al. (2007) Paradoxes of the EphB4 receptor in cancer. Cancer Res. 67(9): 3994-7.
  • Taylor AC, et al. (2007) EphB4 expression along adult rat microvascular networks: EphB4 is more than a venous specific marker. Microcirculation. 14(3): 253-67.
  • Size / Price
    Catalog: MG50582-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"