Quick Order

Text Size:AAA

Mouse EphB4/Eph Receptor B4 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse EPHB4 cDNA Clone Product Information
NCBI RefSeq:NM_010144.6
RefSeq ORF Size:2964bp
cDNA Description:Full length Clone DNA of Mus musculus Eph receptor B4 with C terminal HA tag.
Gene Synonym:Htk, MDK2, Myk1, Tyro11, AI042935, Ephb4
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 861A/G,1077A/T,2565T/C,2718T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Ephrin type-B receptor 4 is a protein that in humans is encoded by the EPHB4 gene. It is a single-pass type I membrane protein belonging to the ephrin receptor subfamily of protein kinase superfamily. Members of the ephrin and Eph family are local mediators of cell function through largely contact-dependent processes in development and in maturity. Furthermore, EphB4 protein and the corresponding ligand Ephrin-B2 contribute to tumor growth in various human tumors. EphB4 protein has tumor suppressor activities and that regulation of cell proliferation, extracellular matrix remodeling, and invasive potential are important mechanisms of tumor suppression. Therefore, Ephrin-B2/EphB4 may be recognized as a novel prognostic indicator for cancers.

References
  • Davalos V, et al. (2006) EPHB4 and survival of colorectal cancer patients. Cancer Res. 66(18): 8943-8.
  • Zhao C, et al. (2006) Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab. 4(2): 111-21.
  • Kertesz N, et al. (2006) The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth. Blood. 107(6): 2330-8.
  • Noren NK, et al. (2007) Paradoxes of the EphB4 receptor in cancer. Cancer Res. 67(9): 3994-7.
  • Taylor AC, et al. (2007) EphB4 expression along adult rat microvascular networks: EphB4 is more than a venous specific marker. Microcirculation. 14(3): 253-67.
  • Size / Price
    Catalog: MG50582-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"