EphB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50479-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EphB1 Reagents
CRO Services
Product recommended

All EphB1 Reagents
EphB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2955 bp
Description
Full length Clone DNA of Mouse Eph receptor B1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
9330129L11 cDNA ORF Clone, Mouse;AW488255 cDNA ORF Clone, Mouse;C130099E04Rik cDNA ORF Clone, Mouse;Cek6 cDNA ORF Clone, Mouse;Elk cDNA ORF Clone, Mouse;Elkh cDNA ORF Clone, Mouse;ENSMUSG00000074119 cDNA ORF Clone, Mouse;Hek6 cDNA ORF Clone, Mouse;Net cDNA ORF Clone, Mouse
EphB1 Background Information

Ephrin type-B receptor 1, also known as EphB1, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine formation. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.

Full Name
EPH receptor B1
References
  • Dalva MB, et al. (2000) EphB receptors interact with NMDA receptors and regulate excitatory synapse formation. Cell. 103(6): 945-56.
  • Takasu MA, et al. (2002) Modulation of NMDA receptor-dependent calcium influx and gene expression through EphB receptors. Science. 295(5554): 491-5.
  • Adams RH, et al. (1999) Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis. Genes Dev. 13(3): 295-306.
  • info info
    添加购物车成功! 添加购物车失败!