EphA7 cDNA ORF Clone, Mouse, C-His tag

Cat: MG50587-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EphA7 Reagents
CRO Services
Product recommended

All EphA7 Reagents
EphA7 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2997 bp
Description
Full length Clone DNA of Mouse Eph receptor A7 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphA7 cDNA ORF Clone, Mouse, C-His tag Alternative Names
Cek11 cDNA ORF Clone, Mouse;Ebk cDNA ORF Clone, Mouse;Ehk3 cDNA ORF Clone, Mouse;Hek11 cDNA ORF Clone, Mouse;Mdk1 cDNA ORF Clone, Mouse;RP23-33D17.1 cDNA ORF Clone, Mouse
EphA7 Background Information

Ephrin type-A receptor 7, also known as EphA7, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Eph receptor-mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. Down-regulation of EphA7 secondary to hypermethylation has been reported in colorectal cancer. The expression of EphA7 was reduced in all tested gastric cancer cell lines; however, there is marked variability in expression among gastric carcinoma specimens. EphA7 may have roles in the pathogenesis and development of gastric carcinomas.

Full Name
Eph receptor A7
References
  • Rashid T, et al. (2005) Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for topographic mapping in the mammalian visual system. Neuron. 47(1): 57-69.
  • Wang J, et al. (2007) Differential expression of EphA7 receptor tyrosine kinase in gastric carcinoma. Hum Pathol. 38(11): 1649-56.
  • Rogers JH, et al. (1999) Distribution of the receptor EphA7 and its ligands in development of the mouse nervous system. Brain Res Mol Brain Res. 74(1-2): 225-30.
  • EphA7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphA7 cDNA ORF Clone in Cloning Vector, Mouse MG50587-M
    EphA7 cDNA ORF Clone, Mouse, untagged MG50587-UT
    EphA7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50587-ACGLN
    EphA7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50587-ACG
    EphA7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50587-ACR
    EphA7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50587-CF
    EphA7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50587-NF
    EphA7 cDNA ORF Clone, Mouse, N-His tag MG50587-NH
    EphA7 cDNA ORF Clone, Mouse, C-HA tag MG50587-CY
    EphA7 cDNA ORF Clone, Mouse, N-HA tag MG50587-NY
    EphA7 cDNA ORF Clone, Mouse, C-Myc tag MG50587-CM
    EphA7 cDNA ORF Clone, Mouse, N-Myc tag MG50587-NM
    EphA7 qPCR Primer Pairs, Mouse MP200579

    EphA7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphA7 cDNA ORF Clone in Cloning Vector, Human HG11657-M
    EphA7 cDNA ORF Clone, Human, untagged HG11657-UT
    EphA7 cDNA ORF Clone, Human, C-GFPSpark® tag HG11657-ACG
    EphA7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11657-ACGLN
    EphA7 cDNA ORF Clone, Human, C-OFPSpark® tag HG11657-ACR
    EphA7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11657-CF
    EphA7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11657-NF
    EphA7 cDNA ORF Clone, Human, C-His tag HG11657-CH
    EphA7 cDNA ORF Clone, Human, N-His tag HG11657-NH
    EphA7 cDNA ORF Clone, Human, C-HA tag HG11657-CY
    EphA7 cDNA ORF Clone, Human, N-HA tag HG11657-NY
    EphA7 cDNA ORF Clone, Human, C-Myc tag HG11657-CM
    EphA7 cDNA ORF Clone, Human, N-Myc tag HG11657-NM
    EphA7 qPCR Primer Pairs, Human HP101502

    EphA7 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EphA7 qPCR Primer Pairs, Rat RP300104
    info info
    添加购物车成功! 添加购物车失败!