Quick Order

Mouse EphA7/Eph Receptor A7 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse EPHA7 cDNA Clone Product Information
NCBI RefSeq:NM_010141.3
RefSeq ORF Size:2997bp
cDNA Description:Full length Clone DNA of Mus musculus Eph receptor A7 with C terminal Myc tag.
Gene Synonym:Ebk, Ehk3, Mdk1, Cek11, Hek11, Epha7
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ephrin type-A receptor 7, also known as EphA7, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Eph receptor-mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. Down-regulation of EphA7 secondary to hypermethylation has been reported in colorectal cancer. The expression of EphA7 was reduced in all tested gastric cancer cell lines; however, there is marked variability in expression among gastric carcinoma specimens. EphA7 may have roles in the pathogenesis and development of gastric carcinomas.

References
  • Rashid T, et al. (2005) Opposing gradients of ephrin-As and EphA7 in the superior colliculus are essential for topographic mapping in the mammalian visual system. Neuron. 47(1): 57-69.
  • Wang J, et al. (2007) Differential expression of EphA7 receptor tyrosine kinase in gastric carcinoma. Hum Pathol. 38(11): 1649-56.
  • Rogers JH, et al. (1999) Distribution of the receptor EphA7 and its ligands in development of the mouse nervous system. Brain Res Mol Brain Res. 74(1-2): 225-30.
  • Size / Price
    Catalog: MG50587-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"