EphA2 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50586-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EphA2 Reagents
CRO Services
Product recommended

All EphA2 Reagents
EphA2 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2934 bp
Description
Full length Clone DNA of Mouse Eph receptor A2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphA2 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AW545284 cDNA ORF Clone, Mouse;Eck cDNA ORF Clone, Mouse;Myk2 cDNA ORF Clone, Mouse;Sek-2 cDNA ORF Clone, Mouse;Sek2 cDNA ORF Clone, Mouse
EphA2 Background Information

Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. The Eph receptors' corresponding family of ligands are the ephrins anchored to cell surfaces. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps. They have also been found implicated in embryonic patterning, neuronal targeting, vascular development and adult neovascularization. The large family of ligands and receptors may make a major contribution to the accurate spatial patterning of connections and cell position in the nervous system. Furthermore, elevated expression of Eph receptors and ephrin ligands is associated with tumors and associated tumor vasculature, suggesting the Eph receptors and ephrin ligands also play critical roles in tumor angiogenesis and tumor growth. Unlike most Eph kinases, which are primarily expressed during development, EphA2 is primarily found in adult human epithelial cells. The cellular functions of EphA2 may be regulating cell growth, survival, migration, and angiogenesis.Unlike other receptor tyrosine kinases, ligand binding is not necessary for EphA2. Rather, the ligand appears to regulate EphA2 subcellular localization and its interactions with downstream adapter and signaling proteins. Eph receptor A2(EphA2) has been demonstrated to critically regulate tumor cell growth, migration and invasiveness. Eph receptor A2(EphA2) is frequently overexpressed and functionally altered in aggressive tumor cells, and that these changes promote metastatic character.

Full Name
EPH receptor A2
References
  • Flanagan JG, et al. (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 21: 309-45.
  • Cheng N, et al. (2002) The ephrins and Eph receptors in angiogenesis. Cytokine Growth Factor Rev. 13(1): 75-85.
  • Pratt RL, et al. (2002) Activation of the EphA2 tyrosine kinase stimulates the MAP/ERK kinase signaling cascade. Oncogene. 21(50): 7690-9.
  • Jennifer Walker-Daniels, et al. (2003) Differential Regulation of EphA2 in Normal and Malignant Cells. Am J Pathol. 162(4): 1037-1042.
  • EphA2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphA2 cDNA ORF Clone in Cloning Vector, Mouse MG50586-G
    EphA2 cDNA ORF Clone, Mouse, untagged MG50586-UT
    EphA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50586-ACG
    EphA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50586-ACGLN
    EphA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50586-ACR
    EphA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50586-CF
    EphA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50586-NF
    EphA2 cDNA ORF Clone, Mouse, C-His tag MG50586-CH
    EphA2 cDNA ORF Clone, Mouse, N-His tag MG50586-NH
    EphA2 cDNA ORF Clone, Mouse, C-HA tag MG50586-CY
    EphA2 cDNA ORF Clone, Mouse, N-HA tag MG50586-NY
    EphA2 cDNA ORF Clone, Mouse, N-Myc tag MG50586-NM
    EphA2 qPCR Primer Pairs, Mouse MP200578

    EphA2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphA2 cDNA ORF Clone in Cloning Vector, Human HG13926-G
    EphA2 cDNA ORF Clone, Human, untagged HG13926-UT
    EphA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13926-ACGLN
    EphA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13926-ACG
    EphA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13926-ACR
    EphA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13926-CF
    EphA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13926-NF
    EphA2 cDNA ORF Clone, Human, C-His tag HG13926-CH
    EphA2 cDNA ORF Clone, Human, N-His tag HG13926-NH
    EphA2 cDNA ORF Clone, Human, C-HA tag HG13926-CY
    EphA2 cDNA ORF Clone, Human, N-HA tag HG13926-NY
    EphA2 cDNA ORF Clone, Human, C-Myc tag HG13926-CM
    EphA2 cDNA ORF Clone, Human, N-Myc tag HG13926-NM
    EphA2 qPCR Primer Pairs, Human HP102591
    info info
    添加购物车成功! 添加购物车失败!