ENTPD6 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50286-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ENTPD6 Reagents
CRO Services
Product recommended

All ENTPD6 Reagents
ENTPD6 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1368 bp
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENTPD6 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2700026H11Rik cDNA ORF Clone, Mouse;Cd39l2 cDNA ORF Clone, Mouse;NTPDase-6 cDNA ORF Clone, Mouse
ENTPD6 Background Information
Full Name
ectonucleoside triphosphate diphosphohydrolase 6 (putative)

ENTPD6 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ENTPD6 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90664-G
ENTPD6 cDNA ORF Clone, Cynomolgus, untagged CG90664-UT
ENTPD6 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90664-ACG
ENTPD6 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90664-ACGLN
ENTPD6 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90664-ACR
ENTPD6 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90664-CF
ENTPD6 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90664-NF
ENTPD6 cDNA ORF Clone, Cynomolgus, C-His tag CG90664-CH
ENTPD6 cDNA ORF Clone, Cynomolgus, N-His tag CG90664-NH
ENTPD6 cDNA ORF Clone, Cynomolgus, C-HA tag CG90664-CY
ENTPD6 cDNA ORF Clone, Cynomolgus, N-HA tag CG90664-NY
ENTPD6 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90664-CM
ENTPD6 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90664-NM

ENTPD6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ENTPD6 cDNA ORF Clone in Cloning Vector, Mouse MG50286-M
ENTPD6 cDNA ORF Clone, Mouse, untagged MG50286-UT
ENTPD6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50286-ACG
ENTPD6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50286-ACGLN
ENTPD6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50286-ACR
ENTPD6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50286-CF
ENTPD6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50286-NF
ENTPD6 cDNA ORF Clone, Mouse, C-His tag MG50286-CH
ENTPD6 cDNA ORF Clone, Mouse, N-His tag MG50286-NH
ENTPD6 cDNA ORF Clone, Mouse, C-HA tag MG50286-CY
ENTPD6 cDNA ORF Clone, Mouse, N-HA tag MG50286-NY
ENTPD6 cDNA ORF Clone, Mouse, C-Myc tag MG50286-CM
ENTPD6 qPCR Primer Pairs, Mouse MP200310

ENTPD6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ENTPD6 cDNA ORF Clone in Cloning Vector, Human HG16003-G
ENTPD6 cDNA ORF Clone, Human, untagged HG16003-UT
ENTPD6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16003-ACGLN
ENTPD6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16003-ACG
ENTPD6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16003-ACR
ENTPD6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16003-CF
ENTPD6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16003-NF
ENTPD6 cDNA ORF Clone, Human, C-His tag HG16003-CH
ENTPD6 cDNA ORF Clone, Human, N-His tag HG16003-NH
ENTPD6 cDNA ORF Clone, Human, C-HA tag HG16003-CY
ENTPD6 cDNA ORF Clone, Human, N-HA tag HG16003-NY
ENTPD6 cDNA ORF Clone, Human, C-Myc tag HG16003-CM
ENTPD6 cDNA ORF Clone, Human, N-Myc tag HG16003-NM
ENTPD6 qPCR Primer Pairs, Human HP104589
info info
添加购物车成功! 添加购物车失败!