CD39 cDNA ORF Clone, Mouse, untagged

Cat: MG50398-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD39 Reagents
CRO Services
Product recommended

All CD39 Reagents
CD39 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1533 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 423C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse ectonucleoside triphosphate diphosphohydrolase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.53kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD39 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD39 cDNA ORF Clone, Mouse, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
CD39 cDNA ORF Clone, Mouse, untagged Alternative Names
2610206B08Rik cDNA ORF Clone, Mouse;AA408691 cDNA ORF Clone, Mouse;Cd39 cDNA ORF Clone, Mouse;NTPDase-1 cDNA ORF Clone, Mouse
CD39 Background Information

CD39, also known as ENTPD1, belongs to the GDA1/CD39 NTPase family. It is expressed primarily on activated lymphoid cells and can also be detected in endothelial tissues. The vascular isoform and the placental isoform II are present in both placenta and umbilical vein, whereas placental isoform I is present in placenta only. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. It is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 transgenic mice exhibit impaired platelet aggregation, prolonged bleeding times, and resistance to systemic thromboembolism. There is a correlation between ATP hydrolysis and triglycerides in patients with chronic heart disease, suggesting a relationship between ATP diphosphohydrolase and thrombogenesis. In the nervous system, CD39 could hydrolyze ATP and other nucleotides to regulate purinergic neurotransmission.

Full Name
ectonucleoside triphosphate diphosphohydrolase 1
References
  • Kunzli BM, et al. (2011) Variable impact of CD39 in experimental murine colitis. Dig Dis Sci. 2011 56 (5): 1393-403.
  • Clayton A, et al. (2011) Cancer exosomes express CD39 and CD73, which suppress T cells through adenosine production. J Immunol. 187 (2): 676-83.
  • Loza MJ, et al. (2011) T-cell specific defect in expression of the NTPDase CD39 as a biomarker for lupus. Cell Immunol. 271 (1): 110-7.
  • CD39 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD39 cDNA ORF Clone in Cloning Vector, Rhesus CG90310-G
    CD39 cDNA ORF Clone, Rhesus, untagged CG90310-UT
    CD39 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90310-ACGLN
    CD39 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90310-ACG
    CD39 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90310-ACR
    CD39 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90310-CF
    CD39 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90310-NF
    CD39 cDNA ORF Clone, Rhesus, C-His tag CG90310-CH
    CD39 cDNA ORF Clone, Rhesus, N-His tag CG90310-NH
    CD39 cDNA ORF Clone, Rhesus, C-HA tag CG90310-CY
    CD39 cDNA ORF Clone, Rhesus, N-HA tag CG90310-NY
    CD39 cDNA ORF Clone, Rhesus, C-Myc tag CG90310-CM
    CD39 cDNA ORF Clone, Rhesus, N-Myc tag CG90310-NM

    CD39 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD39 cDNA ORF Clone in Cloning Vector, Mouse MG50398-M
    CD39 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50398-ACGLN
    CD39 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50398-ACG
    CD39 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50398-ACR
    CD39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50398-CF
    CD39 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50398-NF
    CD39 cDNA ORF Clone, Mouse, C-His tag MG50398-CH
    CD39 cDNA ORF Clone, Mouse, N-His tag MG50398-NH
    CD39 cDNA ORF Clone, Mouse, C-HA tag MG50398-CY
    CD39 cDNA ORF Clone, Mouse, N-HA tag MG50398-NY
    CD39 cDNA ORF Clone, Mouse, C-Myc tag MG50398-CM
    CD39 cDNA ORF Clone, Mouse, N-Myc tag MG50398-NM
    CD39 qPCR Primer Pairs, Mouse MP200416

    CD39 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD39 cDNA ORF Clone in Cloning Vector, Human HG16020-G
    CD39 cDNA ORF Clone, Human, untagged HG16020-UT
    CD39 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16020-ACGLN
    CD39 cDNA ORF Clone, Human, C-GFPSpark® tag HG16020-ACG
    CD39 cDNA ORF Clone, Human, C-OFPSpark® tag HG16020-ACR
    CD39 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16020-CF
    CD39 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16020-NF
    CD39 cDNA ORF Clone, Human, C-His tag HG16020-CH
    CD39 cDNA ORF Clone, Human, N-His tag HG16020-NH
    CD39 cDNA ORF Clone, Human, C-HA tag HG16020-CY
    CD39 cDNA ORF Clone, Human, N-HA tag HG16020-NY
    CD39 cDNA ORF Clone, Human, C-Myc tag HG16020-CM
    CD39 cDNA ORF Clone, Human, N-Myc tag HG16020-NM
    info info
    添加购物车成功! 添加购物车失败!