ENPP7 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50567-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ENPP7 Reagents
CRO Services
Product recommended

All ENPP7 Reagents
ENPP7 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1341 bp
Description
Full length Clone DNA of Mouse ectonucleotide pyrophosphatase/phosphodiesterase 7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENPP7 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Alk-SMase cDNA ORF Clone, Mouse;Gm254 cDNA ORF Clone, Mouse
ENPP7 Background Information

Ectonucleotide pyrophosphatase / phosphodiesterase family member 7, also known as Alkaline sphingomyelin phosphodiesterase, Intestinal alkaline sphingomyelinase, Alk-Smase, ENPP7 and NPP-7, is a single-pass type I membrane protein which belongs to the nucleotide pyrophosphatase / phosphodiesterase family. ENPP7 / NPP-7 is expressed in the intestines and human bile. ENPP7 / NPP-7 is localized at the surface of the microvillar membrane in small intestine enterocytes, as well as in endosome-like structures and in Golgi complex. The main function of ENPP7 / NPP-7 is to convert the dietary sphingomyelin into ceramide, the sphingolipid messengers via hydrolyzation. ENPP7 / NPP-7 is also reported to exert a phospholipase C activity toward palmitoyl lyso-phosphocholine. The activity of this enzyme is inhibited in a dose dependent manner by ATP, imidazole, orthovanadate and zinc ion. Further, It has been shown in studies that decreased levels of ENPP7 / NPP-7 may be associated with human colon cancer.

Full Name
ectonucleotide pyrophosphatase/phosphodiesterase 7
References
  • Wu J. et al., 2005, Biochem. J. 386:153-60.
  • Wu J. et al., 2004, Carcinogenesis 25:1327-33.
  • Duan R.-D. et al., 2003, J. Lipid Res. 44:1241-50.
  • Duan R.-D. et al., 2003, J. Biol. Chem. 278:38528-36.
  • ENPP7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ENPP7 cDNA ORF Clone in Cloning Vector, Mouse MG50567-M
    ENPP7 cDNA ORF Clone, Mouse, untagged MG50567-UT
    ENPP7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50567-ACGLN
    ENPP7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50567-ACG
    ENPP7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50567-ACR
    ENPP7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50567-CF
    ENPP7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50567-NF
    ENPP7 cDNA ORF Clone, Mouse, C-His tag MG50567-CH
    ENPP7 cDNA ORF Clone, Mouse, N-His tag MG50567-NH
    ENPP7 cDNA ORF Clone, Mouse, C-HA tag MG50567-CY
    ENPP7 cDNA ORF Clone, Mouse, N-HA tag MG50567-NY
    ENPP7 cDNA ORF Clone, Mouse, N-Myc tag MG50567-NM
    ENPP7 qPCR Primer Pairs, Mouse MP200559

    ENPP7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ENPP7 cDNA ORF Clone in Cloning Vector, Human HG10885-M
    ENPP7 cDNA ORF Clone, Human, untagged HG10885-UT
    ENPP7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10885-ACGLN
    ENPP7 cDNA ORF Clone, Human, C-GFPSpark® tag HG10885-ACG
    ENPP7 cDNA ORF Clone, Human, C-OFPSpark® tag HG10885-ACR
    ENPP7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10885-CF
    ENPP7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10885-NF
    ENPP7 cDNA ORF Clone, Human, C-His tag HG10885-CH
    ENPP7 cDNA ORF Clone, Human, N-His tag HG10885-NH
    ENPP7 cDNA ORF Clone, Human, C-HA tag HG10885-CY
    ENPP7 cDNA ORF Clone, Human, N-HA tag HG10885-NY
    ENPP7 cDNA ORF Clone, Human, C-Myc tag HG10885-CM
    ENPP7 cDNA ORF Clone, Human, N-Myc tag HG10885-NM
    ENPP7 qPCR Primer Pairs, Human HP100771
    info info
    添加购物车成功! 添加购物车失败!