EIF3L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51189-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EIF3L Reagents
CRO Services
Product recommended

All EIF3L Reagents
EIF3L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1695 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 3, subunit L with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF3L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
0610011H21Rik cDNA ORF Clone, Mouse;D15N1e cDNA ORF Clone, Mouse;Eif3eip cDNA ORF Clone, Mouse;Eif3ip cDNA ORF Clone, Mouse;Eif3s6ip cDNA ORF Clone, Mouse;HSP-66Y cDNA ORF Clone, Mouse;PAF67 cDNA ORF Clone, Mouse
EIF3L Background Information
Full Name
eukaryotic translation initiation factor 3, subunit L

EIF3L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF3L cDNA ORF Clone in Cloning Vector, Mouse MG51189-U
EIF3L cDNA ORF Clone, Mouse, untagged MG51189-UT
EIF3L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51189-ACG
EIF3L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51189-ACGLN
EIF3L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51189-ANG
EIF3L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51189-ACR
EIF3L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51189-ANR
EIF3L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51189-NF
EIF3L cDNA ORF Clone, Mouse, C-His tag MG51189-CH
EIF3L cDNA ORF Clone, Mouse, N-His tag MG51189-NH
EIF3L cDNA ORF Clone, Mouse, C-HA tag MG51189-CY
EIF3L cDNA ORF Clone, Mouse, N-HA tag MG51189-NY
EIF3L cDNA ORF Clone, Mouse, C-Myc tag MG51189-CM
EIF3L cDNA ORF Clone, Mouse, N-Myc tag MG51189-NM
EIF3L qPCR Primer Pairs, Mouse MP201073

EIF3L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF3L cDNA ORF Clone in Cloning Vector, Human HG16547-U
EIF3L cDNA ORF Clone, Human, untagged HG16547-UT
EIF3L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16547-ACGLN
EIF3L cDNA ORF Clone, Human, C-GFPSpark® tag HG16547-ACG
EIF3L cDNA ORF Clone, Human, N-GFPSpark® tag HG16547-ANG
EIF3L cDNA ORF Clone, Human, C-OFPSpark® tag HG16547-ACR
EIF3L cDNA ORF Clone, Human, N-OFPSpark® tag HG16547-ANR
EIF3L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16547-CF
EIF3L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16547-NF
EIF3L cDNA ORF Clone, Human, C-His tag HG16547-CH
EIF3L cDNA ORF Clone, Human, N-His tag HG16547-NH
EIF3L cDNA ORF Clone, Human, C-HA tag HG16547-CY
EIF3L cDNA ORF Clone, Human, N-HA tag HG16547-NY
EIF3L cDNA ORF Clone, Human, C-Myc tag HG16547-CM
EIF3L cDNA ORF Clone, Human, N-Myc tag HG16547-NM
info info
添加购物车成功! 添加购物车失败!