eIF3K cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52829-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All eIF3K Reagents
CRO Services
Product recommended

All eIF3K Reagents
eIF3K cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 3, subunit K with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF3K cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1200009C21Rik cDNA ORF Clone, Mouse;Eif3s12 cDNA ORF Clone, Mouse
eIF3K Background Information

EIF3K is a member of the eIF3 subunit K family. It is a component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). It stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. EIF3K is universally expressed in human tissues. It is distributed both in nucleus and cytoplasm. EIF3K is the smallest subunit of eIF3 and it interacts with a number of other subunits of eIF3 and the 40S ribosomal subunit.

Full Name
eukaryotic translation initiation factor 3, subunit K
References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Shen X. et al., 2004, FEBS Lett. 573 (1-3): 139-46.
  • Wei Z. et al., 2004, J Biol Chem. 279 (33): 34983-90.
  • eIF3K cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    eIF3K cDNA ORF Clone in Cloning Vector, Mouse MG52829-U
    eIF3K cDNA ORF Clone, Mouse, untagged MG52829-UT
    eIF3K Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52829-ACGLN
    eIF3K cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52829-ACG
    eIF3K cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52829-ANG
    eIF3K cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52829-ACR
    eIF3K cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52829-ANR
    eIF3K cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52829-CF
    eIF3K cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52829-NF
    eIF3K cDNA ORF Clone, Mouse, C-His tag MG52829-CH
    eIF3K cDNA ORF Clone, Mouse, N-His tag MG52829-NH
    eIF3K cDNA ORF Clone, Mouse, C-HA tag MG52829-CY
    eIF3K cDNA ORF Clone, Mouse, C-Myc tag MG52829-CM
    eIF3K cDNA ORF Clone, Mouse, N-Myc tag MG52829-NM

    eIF3K cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    eIF3K cDNA ORF Clone in Cloning Vector, Human HG14553-U
    eIF3K cDNA ORF Clone, Human, untagged HG14553-UT
    eIF3K cDNA ORF Clone, Human, C-GFPSpark® tag HG14553-ACG
    eIF3K Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14553-ACGLN
    eIF3K cDNA ORF Clone, Human, N-GFPSpark® tag HG14553-ANG
    eIF3K cDNA ORF Clone, Human, C-OFPSpark® tag HG14553-ACR
    eIF3K cDNA ORF Clone, Human, N-OFPSpark® tag HG14553-ANR
    eIF3K cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14553-CF
    eIF3K cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14553-NF
    eIF3K cDNA ORF Clone, Human, C-His tag HG14553-CH
    eIF3K cDNA ORF Clone, Human, N-His tag HG14553-NH
    eIF3K cDNA ORF Clone, Human, C-HA tag HG14553-CY
    eIF3K cDNA ORF Clone, Human, N-HA tag HG14553-NY
    eIF3K cDNA ORF Clone, Human, C-Myc tag HG14553-CM
    eIF3K cDNA ORF Clone, Human, N-Myc tag HG14553-NM
    info info
    添加购物车成功! 添加购物车失败!