After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EIF3K Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse EIF3K cDNA Clone Product Information
NCBI RefSeq:NM_028659.3
RefSeq ORF Size:657bp
cDNA Description:Full length Clone DNA of Mus musculus eukaryotic translation initiation factor 3, subunit K with N terminal His tag.
Gene Synonym:Eif3s12; 1200009C21Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

EIF3K is a member of the eIF3 subunit K family. It is a component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). It stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. EIF3K is universally expressed in human tissues. It is distributed both in nucleus and cytoplasm. EIF3K is the smallest subunit of eIF3 and it interacts with a number of other subunits of eIF3 and the 40S ribosomal subunit.

References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Shen X. et al., 2004, FEBS Lett. 573 (1-3): 139-46.
  • Wei Z. et al., 2004, J Biol Chem. 279 (33): 34983-90.
  • Size / Price
    Catalog: MG52829-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"