EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52021-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF3H/EIF3S3 Reagents
CRO Services
Product recommended

All EIF3H/EIF3S3 Reagents
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 3, subunit H with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1110008A16Rik cDNA ORF Clone, Mouse;40kD cDNA ORF Clone, Mouse;9430017H16Rik cDNA ORF Clone, Mouse;EIF3-gamma cDNA ORF Clone, Mouse;EIF3-P40 cDNA ORF Clone, Mouse;Eif3s3 cDNA ORF Clone, Mouse
EIF3H/EIF3S3 Background Information
Full Name
eukaryotic translation initiation factor 3, subunit H

EIF3H/EIF3S3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF3H/EIF3S3 cDNA ORF Clone in Cloning Vector, Mouse MG52021-G
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, untagged MG52021-UT
EIF3H/EIF3S3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52021-ACGLN
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52021-ACG
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52021-ANG
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52021-ACR
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52021-ANR
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52021-CF
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52021-NF
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, C-His tag MG52021-CH
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-His tag MG52021-NH
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, C-HA tag MG52021-CY
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, N-HA tag MG52021-NY
EIF3H/EIF3S3 cDNA ORF Clone, Mouse, C-Myc tag MG52021-CM
EIF3H/EIF3S3 qPCR Primer Pairs, Mouse MP201894

EIF3H/EIF3S3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF3H/EIF3S3 cDNA ORF Clone in Cloning Vector, Human HG16405-G
EIF3H/EIF3S3 cDNA ORF Clone, Human, untagged HG16405-UT
EIF3H/EIF3S3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16405-ACGLN
EIF3H/EIF3S3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16405-ACG
EIF3H/EIF3S3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16405-ANG
EIF3H/EIF3S3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16405-ACR
EIF3H/EIF3S3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16405-ANR
EIF3H/EIF3S3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16405-CF
EIF3H/EIF3S3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16405-NF
EIF3H/EIF3S3 cDNA ORF Clone, Human, C-His tag HG16405-CH
EIF3H/EIF3S3 cDNA ORF Clone, Human, N-His tag HG16405-NH
EIF3H/EIF3S3 cDNA ORF Clone, Human, C-HA tag HG16405-CY
EIF3H/EIF3S3 cDNA ORF Clone, Human, N-HA tag HG16405-NY
EIF3H/EIF3S3 cDNA ORF Clone, Human, C-Myc tag HG16405-CM
EIF3H/EIF3S3 cDNA ORF Clone, Human, N-Myc tag HG16405-NM
EIF3H/EIF3S3 qPCR Primer Pairs, Human HP105154
info info
添加购物车成功! 添加购物车失败!