EIF2S2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51543-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EIF2S2 Reagents
CRO Services
Product recommended

All EIF2S2 Reagents
EIF2S2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
996 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 2, subunit 2 (beta) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF2S2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2810026E11Rik cDNA ORF Clone, Mouse;38kDa cDNA ORF Clone, Mouse;AA408636 cDNA ORF Clone, Mouse;AA571381 cDNA ORF Clone, Mouse;AA986487 cDNA ORF Clone, Mouse;AW822225 cDNA ORF Clone, Mouse;D2Ertd303e cDNA ORF Clone, Mouse;EIF2 cDNA ORF Clone, Mouse;EIF2B cDNA ORF Clone, Mouse
EIF2S2 Background Information
Full Name
eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa

EIF2S2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF2S2 cDNA ORF Clone in Cloning Vector, Mouse MG51543-G
EIF2S2 cDNA ORF Clone, Mouse, untagged MG51543-UT
EIF2S2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51543-ACG
EIF2S2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51543-ACGLN
EIF2S2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51543-ANG
EIF2S2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51543-ACR
EIF2S2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51543-ANR
EIF2S2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51543-CF
EIF2S2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51543-NF
EIF2S2 cDNA ORF Clone, Mouse, C-His tag MG51543-CH
EIF2S2 cDNA ORF Clone, Mouse, C-HA tag MG51543-CY
EIF2S2 cDNA ORF Clone, Mouse, N-HA tag MG51543-NY
EIF2S2 cDNA ORF Clone, Mouse, C-Myc tag MG51543-CM
EIF2S2 cDNA ORF Clone, Mouse, N-Myc tag MG51543-NM
EIF2S2 qPCR Primer Pairs, Mouse MP201427

EIF2S2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF2S2 cDNA ORF Clone in Cloning Vector, Human HG16878-U
EIF2S2 cDNA ORF Clone, Human, untagged HG16878-UT
EIF2S2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16878-ACGLN
EIF2S2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16878-ACG
EIF2S2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16878-ANG
EIF2S2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16878-ACR
EIF2S2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16878-ANR
EIF2S2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16878-CF
EIF2S2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16878-NF
EIF2S2 cDNA ORF Clone, Human, C-His tag HG16878-CH
EIF2S2 cDNA ORF Clone, Human, N-His tag HG16878-NH
EIF2S2 cDNA ORF Clone, Human, C-HA tag HG16878-CY
EIF2S2 cDNA ORF Clone, Human, N-HA tag HG16878-NY
EIF2S2 cDNA ORF Clone, Human, C-Myc tag HG16878-CM
EIF2S2 cDNA ORF Clone, Human, N-Myc tag HG16878-NM
info info
添加购物车成功! 添加购物车失败!