EGFL7 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50472-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EGFL7 Reagents
CRO Services
Product recommended

All EGFL7 Reagents
EGFL7 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Mouse EGF-like domain 7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGFL7 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
VE-statin cDNA ORF Clone, Mouse;Zneu1 cDNA ORF Clone, Mouse
EGFL7 Background Information

Epidermal growth factor-like protein 7, also known as EGF-like protein 7, Multiple epidermal growth factor-like domains protein 7, Multiple EGF-like domains protein 7, Vascular endothelial statin, NOTCH4-like protein and EGFL7, is a secreted protein which contains two EGF-like domains and one EMI domain. EGFL7 was identified by a number of groups as a putative secreted factor produced by the vascular endothelial cells (ECs). EGFL7 is described as a novel endothelial cell-derived factor involved in the regulation of the spatial arrangement of cells during vascular tube assembly. With its impact on tubulogenesis and vessel shape EGFL7 joined the large family of molecules governing blood vessel formation. EGFL7 regulates midline angioblast migration in zebrafish embryos-a key step in vascular tubulogenesis. EGFL7 is tightly associated with the extracellular matrix (ECM), and it supports EC migration either as a single factor or in combination with other ECM molecules. EGFL7 provides a proper microenvironment for endothelial cell migration, thereby enabling accurate patterning. Our study indicates that the molecular composition of the ECM influences vascular morphogenesis. EGFL7 also regulates vascular tubulogenesis. It inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cells adhesion to the substrate.

Full Name
EGF-like-domain, multiple 7
References
  • Fitch,M.J. et al., 2004, Dev Dyn. 230 (2):316-24.
  • Schmidt,M. et al., 2007, Novartis Found Symp. 283 :18-28.
  • Campagnolo,L.et al., 2008, Gene Expr Patterns  8 (6):389-96.
  • Picuric,S. et al., 2009, Protein Expr Purif. 68 (1):1-6.
  • Nikolic,I. et al., 2010, J Angiogenes Res. 2 (1): 9. 
  • EGFL7 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EGFL7 cDNA ORF Clone in Cloning Vector, Rat RG8A4324-U
    EGFL7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4324-ACGLN

    EGFL7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EGFL7 cDNA ORF Clone in Cloning Vector, Mouse MG50472-M
    EGFL7 cDNA ORF Clone, Mouse, untagged MG50472-UT
    EGFL7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50472-ACG
    EGFL7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50472-ACGLN
    EGFL7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50472-ACR
    EGFL7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50472-CF
    EGFL7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50472-NF
    EGFL7 cDNA ORF Clone, Mouse, C-His tag MG50472-CH
    EGFL7 cDNA ORF Clone, Mouse, N-His tag MG50472-NH
    EGFL7 cDNA ORF Clone, Mouse, C-HA tag MG50472-CY
    EGFL7 cDNA ORF Clone, Mouse, N-HA tag MG50472-NY
    EGFL7 cDNA ORF Clone, Mouse, N-Myc tag MG50472-NM
    EGFL7 qPCR Primer Pairs, Mouse MP200469

    EGFL7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EGFL7 cDNA ORF Clone in Cloning Vector, Human HG11979-G
    EGFL7 cDNA ORF Clone, Human, untagged HG11979-UT
    EGFL7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11979-ACGLN
    EGFL7 cDNA ORF Clone, Human, C-GFPSpark® tag HG11979-ACG
    EGFL7 cDNA ORF Clone, Human, C-OFPSpark® tag HG11979-ACR
    EGFL7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11979-CF
    EGFL7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11979-NF
    EGFL7 cDNA ORF Clone, Human, C-His tag HG11979-CH
    EGFL7 cDNA ORF Clone, Human, N-His tag HG11979-NH
    EGFL7 cDNA ORF Clone, Human, C-HA tag HG11979-CY
    EGFL7 cDNA ORF Clone, Human, N-HA tag HG11979-NY
    EGFL7 cDNA ORF Clone, Human, C-Myc tag HG11979-CM
    EGFL7 cDNA ORF Clone, Human, N-Myc tag HG11979-NM
    EGFL7 qPCR Primer Pairs, Human HP101524
    info info
    添加购物车成功! 添加购物车失败!