Quick Order

Mouse Epidermal Growth Factor/EGF Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse EGF cDNA Clone Product Information
NCBI RefSeq:NM_010113.3
RefSeq ORF Size:3654bp
cDNA Description:Full length Clone DNA of Mus musculus epidermal growth factor with C terminal His tag.
Gene Synonym:AI790464
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly similar structural and functional characteristics. EGF contains 9 EGF-like domains and 9 LDL-receptor class B repeats. Human EGF is a 6045-Da protein with 53 amino acid residues and three intramolecular disulfide bonds. As a low-molecular-weight polypeptide, EGF was first purified from the mouse submandibular gland, but since then it was found in many human tissues including submandibular gland, parotid gland. It can also be found in human platelets, macrophages, urine, saliva, milk, and plasma. EGF is a growth factor that stimulates the growth of various epidermal and epithelial tissues in vivo and in vitro and of some fibroblasts in cell culture. It results in cellular proliferation, differentiation, and survival. Salivary EGF, which seems also regulated by dietary inorganic iodine, also plays an important physiological role in the maintenance of oro-esophageal and gastric tissue integrity. EGF acts by binding with high affinity to epidermal growth factor receptor on the cell surface and stimulating the intrinsic protein-tyrosine kinase activity of the receptor. The tyrosine kinase activity, in turn, initiates a signal transduction cascade that results in a variety of biochemical changes within the cell - a rise in intracellular calcium levels, increased glycolysis and protein synthesis, and increases in the expression of certain genes including the gene for EGFR - that ultimately lead to DNA synthesis and cell proliferation.

References
  • Chen JX, et al. (2011) Involvement of c-Src/STAT3 signal in EGF-induced proliferation of rat spermatogonial stem cells. Mol Cell Biochem. 358(1-2):67-73.
  • Guo Y, et al. (2012) Correlations among ERCC1, XPB, UBE2I, EGF, TAL2 and ILF3 revealed by gene signatures of histological subtypes of patients with epithelial ovarian cancer. Oncol Rep. 27(1):286-92.
  • Kim S, et al. (2012) Smad7 acts as a negative regulator of the epidermal growth factor (EGF) signaling pathway in breast cancer cells. Cancer Lett. 314(2):147-54.
  • Chatterton RT Jr, et al. (2010) Breast ductal lavage for assessment of breast cancer biomarkers. Horm Cancer. 1(4):197-204.
  • Size / Price
    Catalog: MG50482-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"