Ephrin B2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50598-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ephrin B2 Reagents
CRO Services
Product recommended

All Ephrin B2 Reagents
Ephrin B2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1011 bp
Description
Full length Clone DNA of Mouse Ephrin-B2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin B2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
ELF-2 cDNA ORF Clone, Mouse;Epl5 cDNA ORF Clone, Mouse;Eplg5 cDNA ORF Clone, Mouse;Htk-L cDNA ORF Clone, Mouse;LERK-5 cDNA ORF Clone, Mouse;Lerk5 cDNA ORF Clone, Mouse;NLERK-1 cDNA ORF Clone, Mouse
Ephrin B2 Background Information

EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing arterial versus venous identity and perhaps in anastamosing arterial and venous vessels at their junctions. The transmembrane-associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB2 expression progressively extends from the arterial endothelium to surrounding smooth muscle cells and to pericytes, suggesting that ephrin-B2 may play an important role during formation of the arterial muscle wall.

Full Name
ephrin-B2
References
  • Wang HU, et al. (1998) Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell. 93(5): 741-53.
  • Gale NW, et al. (2001) Ephrin-B2 selectively marks arterial vessels and neovascularization sites in the adult, with expression in both endothelial and smooth-muscle cells. Dev Biol. 230(2): 151-60.
  • Shin D, et al. (2001) Expression of ephrinB2 identifies a stable genetic difference between arterial and venous vascular smooth muscle as well as endothelial cells, and marks subsets of microvessels at sites of adult neovascularization. Dev Biol. 230(2): 139-50.
  • Ephrin B2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Ephrin B2 cDNA ORF Clone in Cloning Vector, Canine DG70073-G
    Ephrin B2 cDNA ORF Clone, Canine, untagged DG70073-UT
    Ephrin B2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70073-ACG
    Ephrin B2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70073-ACGLN
    Ephrin B2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70073-ACR
    Ephrin B2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70073-CF
    Ephrin B2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70073-NF
    Ephrin B2 cDNA ORF Clone, Canine, C-His tag DG70073-CH
    Ephrin B2 cDNA ORF Clone, Canine, N-His tag DG70073-NH
    Ephrin B2 cDNA ORF Clone, Canine, C-HA tag DG70073-CY
    Ephrin B2 cDNA ORF Clone, Canine, N-HA tag DG70073-NY
    Ephrin B2 cDNA ORF Clone, Canine, C-Myc tag DG70073-CM
    Ephrin B2 cDNA ORF Clone, Canine, N-Myc tag DG70073-NM

    Ephrin B2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ephrin B2 cDNA ORF Clone in Cloning Vector, Rat RG80107-G
    Ephrin B2 cDNA ORF Clone, Rat, untagged RG80107-UT
    Ephrin B2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80107-ACGLN
    Ephrin B2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80107-ACG
    Ephrin B2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80107-ACR
    Ephrin B2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80107-CF
    Ephrin B2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80107-NF
    Ephrin B2 cDNA ORF Clone, Rat, C-His tag RG80107-CH
    Ephrin B2 cDNA ORF Clone, Rat, N-His tag RG80107-NH
    Ephrin B2 cDNA ORF Clone, Rat, C-HA tag RG80107-CY
    Ephrin B2 cDNA ORF Clone, Rat, N-HA tag RG80107-NY
    Ephrin B2 cDNA ORF Clone, Rat, C-Myc tag RG80107-CM
    Ephrin B2 cDNA ORF Clone, Rat, N-Myc tag RG80107-NM
    Ephrin B2 qPCR Primer Pairs, Rat RP300102

    Ephrin B2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ephrin B2 cDNA ORF Clone, Mouse, untagged MG50598-UT
    Ephrin B2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50598-ACG
    Ephrin B2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50598-ACGLN
    Ephrin B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50598-CF
    Ephrin B2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50598-NF
    Ephrin B2 cDNA ORF Clone, Mouse, C-His tag MG50598-CH
    Ephrin B2 cDNA ORF Clone, Mouse, N-His tag MG50598-NH
    Ephrin B2 cDNA ORF Clone, Mouse, N-HA tag MG50598-NY
    Ephrin B2 cDNA ORF Clone, Mouse, C-Myc tag MG50598-CM
    Ephrin B2 cDNA ORF Clone, Mouse, N-Myc tag MG50598-NM
    Ephrin B2 qPCR Primer Pairs, Mouse MP200069

    Ephrin B2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ephrin B2 cDNA ORF Clone in Cloning Vector, Human HG10881-M
    Ephrin B2 cDNA ORF Clone, Human, untagged HG10881-UT
    Ephrin B2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10881-ACGLN
    Ephrin B2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10881-ACG
    Ephrin B2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10881-ACR
    Ephrin B2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10881-CF
    Ephrin B2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10881-NF
    Ephrin B2 cDNA ORF Clone, Human, C-His tag HG10881-CH
    Ephrin B2 cDNA ORF Clone, Human, N-His tag HG10881-NH
    Ephrin B2 cDNA ORF Clone, Human, C-HA tag HG10881-CY
    Ephrin B2 cDNA ORF Clone, Human, N-HA tag HG10881-NY
    Ephrin B2 cDNA ORF Clone, Human, C-Myc tag HG10881-CM
    Ephrin B2 cDNA ORF Clone, Human, N-Myc tag HG10881-NM
    Ephrin B2 qPCR Primer Pairs, Human HP100767
    info info
    添加购物车成功! 添加购物车失败!