After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse EFNB2/Ephrin-B2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse EFNB2 cDNA Clone Product Information
NCBI RefSeq:NM_010111.5
RefSeq ORF Size:1011bp
cDNA Description:Full length Clone DNA of Mus musculus Ephrin-B2 with C terminal HA tag.
Gene Synonym:Epl5, ELF-2, Eplg5, Htk-L, Lerk5, LERK-5, NLERK-1, Efnb2
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing arterial versus venous identity and perhaps in anastamosing arterial and venous vessels at their junctions. The transmembrane-associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB2 expression progressively extends from the arterial endothelium to surrounding smooth muscle cells and to pericytes, suggesting that ephrin-B2 may play an important role during formation of the arterial muscle wall.

References
  • Wang HU, et al. (1998) Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell. 93(5): 741-53.
  • Gale NW, et al. (2001) Ephrin-B2 selectively marks arterial vessels and neovascularization sites in the adult, with expression in both endothelial and smooth-muscle cells. Dev Biol. 230(2): 151-60.
  • Shin D, et al. (2001) Expression of ephrinB2 identifies a stable genetic difference between arterial and venous vascular smooth muscle as well as endothelial cells, and marks subsets of microvessels at sites of adult neovascularization. Dev Biol. 230(2): 139-50.
  • Size / Price
    Catalog: MG50598-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"