Ephrin-B1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50580-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ephrin-B1 Reagents
CRO Services
Product recommended

All Ephrin-B1 Reagents
Ephrin-B1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Mouse Ephrin-B1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin-B1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Cek5-L cDNA ORF Clone, Mouse;EFL-3 cDNA ORF Clone, Mouse;Elk-L cDNA ORF Clone, Mouse;Epl2 cDNA ORF Clone, Mouse;Eplg2 cDNA ORF Clone, Mouse;LERK-2 cDNA ORF Clone, Mouse;Lerk2 cDNA ORF Clone, Mouse;Stra1 cDNA ORF Clone, Mouse
Ephrin-B1 Background Information

Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB1 and B class Eph receptors provide positional cues required for the normal morphogenesis of skeletal elements. Another malformation, preaxial polydactyly, was exclusively seen in heterozygous females in which expression of the X-linked ephrinB1 gene was mosaic, so that ectopic EphB-ephrinB1 interactions led to restricted cell movements and the bifurcation of digital rays.

Full Name
ephrin-B1
References
  • Davy A, et al. (2004) Ephrin-B1 forward and reverse signaling are required during mouse development. Genes Dev. 18(5): 572-83.
  • Compagni A, et al. (2003) Control of skeletal patterning by ephrinB1-EphB interactions. Dev Cell. 5(2): 217-30.
  • Wieland I, et al. (2004) Mutations of the ephrin-B1 gene cause craniofrontonasal syndrome. Am J Hum Genet. 74(6): 1209-15.
  • Ephrin-B1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ephrin-B1 cDNA ORF Clone in Cloning Vector, Rat RG80106-G
    Ephrin-B1 cDNA ORF Clone, Rat, untagged RG80106-UT
    Ephrin-B1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80106-ACGLN
    Ephrin-B1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80106-ACG
    Ephrin-B1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80106-ACR
    Ephrin-B1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80106-CF
    Ephrin-B1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80106-NF
    Ephrin-B1 cDNA ORF Clone, Rat, C-His tag RG80106-CH
    Ephrin-B1 cDNA ORF Clone, Rat, N-His tag RG80106-NH
    Ephrin-B1 cDNA ORF Clone, Rat, C-HA tag RG80106-CY
    Ephrin-B1 cDNA ORF Clone, Rat, N-HA tag RG80106-NY
    Ephrin-B1 cDNA ORF Clone, Rat, C-Myc tag RG80106-CM
    Ephrin-B1 cDNA ORF Clone, Rat, N-Myc tag RG80106-NM
    Ephrin-B1 qPCR Primer Pairs, Rat RP300101

    Ephrin-B1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ephrin-B1 cDNA ORF Clone in Cloning Vector, Mouse MG50580-M
    Ephrin-B1 cDNA ORF Clone, Mouse, untagged MG50580-UT
    Ephrin-B1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50580-ACGLN
    Ephrin-B1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50580-ACG
    Ephrin-B1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50580-ACR
    Ephrin-B1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50580-CF
    Ephrin-B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50580-NF
    Ephrin-B1 cDNA ORF Clone, Mouse, C-His tag MG50580-CH
    Ephrin-B1 cDNA ORF Clone, Mouse, N-His tag MG50580-NH
    Ephrin-B1 cDNA ORF Clone, Mouse, C-HA tag MG50580-CY
    Ephrin-B1 cDNA ORF Clone, Mouse, C-Myc tag MG50580-CM
    Ephrin-B1 cDNA ORF Clone, Mouse, N-Myc tag MG50580-NM
    Ephrin-B1 qPCR Primer Pairs, Mouse MP200572

    Ephrin-B1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ephrin-B1 cDNA ORF Clone in Cloning Vector, Human HG10894-M
    Ephrin-B1 cDNA ORF Clone, Human, untagged HG10894-UT
    Ephrin-B1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10894-ACG
    Ephrin-B1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10894-ACGLN
    Ephrin-B1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10894-ACR
    Ephrin-B1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10894-CF
    Ephrin-B1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10894-NF
    Ephrin-B1 cDNA ORF Clone, Human, C-His tag HG10894-CH
    Ephrin-B1 cDNA ORF Clone, Human, N-His tag HG10894-NH
    Ephrin-B1 cDNA ORF Clone, Human, C-HA tag HG10894-CY
    Ephrin-B1 cDNA ORF Clone, Human, N-HA tag HG10894-NY
    Ephrin-B1 cDNA ORF Clone, Human, C-Myc tag HG10894-CM
    Ephrin-B1 cDNA ORF Clone, Human, N-Myc tag HG10894-NM
    Ephrin-B1 qPCR Primer Pairs, Human HP100779
    info info
    添加购物车成功! 添加购物车失败!