Ephrin-B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Ephrin-B1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.05kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**
Ephrin-B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Ephrin-B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
Cek5-L cDNA ORF Clone, Mouse;EFL-3 cDNA ORF Clone, Mouse;Elk-L cDNA ORF Clone, Mouse;Epl2 cDNA ORF Clone, Mouse;Eplg2 cDNA ORF Clone, Mouse;LERK-2 cDNA ORF Clone, Mouse;Lerk2 cDNA ORF Clone, Mouse;Stra1 cDNA ORF Clone, Mouse
Ephrin-B1 Background Information
Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB1 and B class Eph receptors provide positional cues required for the normal morphogenesis of skeletal elements. Another malformation, preaxial polydactyly, was exclusively seen in heterozygous females in which expression of the X-linked ephrinB1 gene was mosaic, so that ectopic EphB-ephrinB1 interactions led to restricted cell movements and the bifurcation of digital rays.
References
Davy A, et al. (2004) Ephrin-B1 forward and reverse signaling are required during mouse development. Genes Dev. 18(5): 572-83.Compagni A, et al. (2003) Control of skeletal patterning by ephrinB1-EphB interactions. Dev Cell. 5(2): 217-30.Wieland I, et al. (2004) Mutations of the ephrin-B1 gene cause craniofrontonasal syndrome. Am J Hum Genet. 74(6): 1209-15.