After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Ephrin-B1/EFNB1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse EFNB1 cDNA Clone Product Information
NCBI RefSeq:NM_010110.4
RefSeq ORF Size:1038bp
cDNA Description:Full length Clone DNA of Mus musculus Ephrin-B1 with C terminal Myc tag.
Gene Synonym:Epl2, EFL-3, Elk-L, Eplg2, Lerk2, Stra1, Cek5-L, LERK-2, Efnb1
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB1 and B class Eph receptors provide positional cues required for the normal morphogenesis of skeletal elements. Another malformation, preaxial polydactyly, was exclusively seen in heterozygous females in which expression of the X-linked ephrinB1 gene was mosaic, so that ectopic EphB-ephrinB1 interactions led to restricted cell movements and the bifurcation of digital rays.

References
  • Davy A, et al. (2004) Ephrin-B1 forward and reverse signaling are required during mouse development. Genes Dev. 18(5): 572-83.
  • Compagni A, et al. (2003) Control of skeletal patterning by ephrinB1-EphB interactions. Dev Cell. 5(2): 217-30.
  • Wieland I, et al. (2004) Mutations of the ephrin-B1 gene cause craniofrontonasal syndrome. Am J Hum Genet. 74(6): 1209-15.
  • Size / Price
    Catalog: MG50580-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"