Ephrin A2 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50579-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ephrin A2 Reagents
CRO Services
Product recommended

All Ephrin A2 Reagents
Ephrin A2 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Mouse Ephrin-A2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin A2 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
CEK7L cDNA ORF Clone, Mouse;Elf1 cDNA ORF Clone, Mouse;Epl6 cDNA ORF Clone, Mouse;Eplg6 cDNA ORF Clone, Mouse;Lerk6 cDNA ORF Clone, Mouse
Ephrin A2 Background Information

Ephrin-A2 also known as EFNA2 or EPH-related receptor tyrosine kinase ligand 6, is a member of the ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A2 and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A2 regulates the position-specific affinity of limb mesenchyme and is involved in cartilage pattern formation in the limb.

Full Name
ephrin-A2
References
  • Feldheim DA, et al. (2000) Genetic analysis of ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of retinocollicular mapping. Neuron. 25(3): 563-74.
  • Jurney WM, et al. (2002) Rac1-mediated endocytosis during ephrin-A2- and semaphorin 3A-induced growth cone collapse. J Neurosci. 22(14): 6019-28.
  • Holmberg J, et al. (2005) Ephrin-A2 reverse signaling negatively regulates neural progenitor proliferation and neurogenesis. Genes Dev. 19(4): 462-71.
  • Ephrin A2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ephrin A2 cDNA ORF Clone in Cloning Vector, Rat RG80110-G
    Ephrin A2 cDNA ORF Clone, Rat, untagged RG80110-UT
    Ephrin A2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80110-ACG
    Ephrin A2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80110-ACGLN
    Ephrin A2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80110-ACR
    Ephrin A2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80110-CF
    Ephrin A2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80110-NF
    Ephrin A2 cDNA ORF Clone, Rat, C-His tag RG80110-CH
    Ephrin A2 cDNA ORF Clone, Rat, N-His tag RG80110-NH
    Ephrin A2 cDNA ORF Clone, Rat, C-HA tag RG80110-CY
    Ephrin A2 cDNA ORF Clone, Rat, N-HA tag RG80110-NY
    Ephrin A2 cDNA ORF Clone, Rat, C-Myc tag RG80110-CM
    Ephrin A2 cDNA ORF Clone, Rat, N-Myc tag RG80110-NM
    Ephrin A2 qPCR Primer Pairs, Rat RP300105

    Ephrin A2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ephrin A2 cDNA ORF Clone in Cloning Vector, Mouse MG50579-M
    Ephrin A2 cDNA ORF Clone, Mouse, untagged MG50579-UT
    Ephrin A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50579-ACG
    Ephrin A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50579-ACGLN
    Ephrin A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50579-ACR
    Ephrin A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50579-CF
    Ephrin A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50579-NF
    Ephrin A2 cDNA ORF Clone, Mouse, C-His tag MG50579-CH
    Ephrin A2 cDNA ORF Clone, Mouse, N-His tag MG50579-NH
    Ephrin A2 cDNA ORF Clone, Mouse, C-HA tag MG50579-CY
    Ephrin A2 cDNA ORF Clone, Mouse, C-Myc tag MG50579-CM
    Ephrin A2 cDNA ORF Clone, Mouse, N-Myc tag MG50579-NM
    Ephrin A2 qPCR Primer Pairs, Mouse MP200571
    info info
    添加购物车成功! 添加购物车失败!