EEFSEC cDNA ORF Clone, Mouse, N-His tag

Cat: MG52918-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EEFSEC Reagents
CRO Services
Product recommended

All EEFSEC Reagents
EEFSEC cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1752 bp
Description
Full length Clone DNA of Mouse eukaryotic elongation factor, selenocysteine-tRNA-specific with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEFSEC cDNA ORF Clone, Mouse, N-His tag Alternative Names
sec cDNA ORF Clone, Mouse;Selb cDNA ORF Clone, Mouse
EEFSEC Background Information
Full Name
eukaryotic elongation factor, selenocysteine-tRNA-specific

EEFSEC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EEFSEC cDNA ORF Clone in Cloning Vector, Mouse MG52918-G
EEFSEC cDNA ORF Clone, Mouse, untagged MG52918-UT
EEFSEC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52918-ACG
EEFSEC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52918-ACGLN
EEFSEC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52918-ANG
EEFSEC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52918-ACR
EEFSEC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52918-ANR
EEFSEC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52918-CF
EEFSEC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52918-NF
EEFSEC cDNA ORF Clone, Mouse, C-His tag MG52918-CH
EEFSEC cDNA ORF Clone, Mouse, C-HA tag MG52918-CY
EEFSEC cDNA ORF Clone, Mouse, N-HA tag MG52918-NY
EEFSEC cDNA ORF Clone, Mouse, C-Myc tag MG52918-CM
EEFSEC cDNA ORF Clone, Mouse, N-Myc tag MG52918-NM

EEFSEC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EEFSEC cDNA ORF Clone in Cloning Vector, Human HG16254-G
EEFSEC cDNA ORF Clone, Human, untagged HG16254-UT
EEFSEC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16254-ACGLN
EEFSEC cDNA ORF Clone, Human, C-GFPSpark® tag HG16254-ACG
EEFSEC cDNA ORF Clone, Human, N-GFPSpark® tag HG16254-ANG
EEFSEC cDNA ORF Clone, Human, C-OFPSpark® tag HG16254-ACR
EEFSEC cDNA ORF Clone, Human, N-OFPSpark® tag HG16254-ANR
EEFSEC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16254-CF
EEFSEC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16254-NF
EEFSEC cDNA ORF Clone, Human, C-His tag HG16254-CH
EEFSEC cDNA ORF Clone, Human, N-His tag HG16254-NH
EEFSEC cDNA ORF Clone, Human, C-HA tag HG16254-CY
EEFSEC cDNA ORF Clone, Human, N-HA tag HG16254-NY
EEFSEC cDNA ORF Clone, Human, C-Myc tag HG16254-CM
EEFSEC cDNA ORF Clone, Human, N-Myc tag HG16254-NM
EEFSEC qPCR Primer Pairs, Human HP105017
info info
添加购物车成功! 添加购物车失败!