EEF1G cDNA ORF Clone, Mouse, untagged

Cat: MG51435-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EEF1G Reagents
CRO Services
Product recommended

All EEF1G Reagents
EEF1G cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Description
Full length Clone DNA of Mouse eukaryotic translation elongation factor 1 gamma
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEF1G cDNA ORF Clone, Mouse, untagged Alternative Names
2610301D06Rik cDNA ORF Clone, Mouse;AA407312 cDNA ORF Clone, Mouse;EF1G cDNA ORF Clone, Mouse
EEF1G Background Information
Full Name
eukaryotic translation elongation factor 1 gamma

EEF1G cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
EEF1G cDNA ORF Clone in Cloning Vector, Rhesus CG90624-G
EEF1G cDNA ORF Clone, Rhesus, untagged CG90624-UT
EEF1G cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90624-ACG
EEF1G Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90624-ACGLN
EEF1G cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90624-ANG
EEF1G cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90624-ACR
EEF1G cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90624-ANR
EEF1G cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90624-CF
EEF1G cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90624-NF
EEF1G cDNA ORF Clone, Rhesus, C-His tag CG90624-CH
EEF1G cDNA ORF Clone, Rhesus, N-His tag CG90624-NH
EEF1G cDNA ORF Clone, Rhesus, C-HA tag CG90624-CY
EEF1G cDNA ORF Clone, Rhesus, N-HA tag CG90624-NY
EEF1G cDNA ORF Clone, Rhesus, C-Myc tag CG90624-CM
EEF1G cDNA ORF Clone, Rhesus, N-Myc tag CG90624-NM

EEF1G cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EEF1G cDNA ORF Clone in Cloning Vector, Rat RG80784-U
EEF1G cDNA ORF Clone, Rat, untagged RG80784-UT
EEF1G cDNA ORF Clone, Rat, C-GFPSpark® tag RG80784-ACG
EEF1G Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80784-ACGLN
EEF1G cDNA ORF Clone, Rat, N-GFPSpark® tag RG80784-ANG
EEF1G cDNA ORF Clone, Rat, C-OFPSpark® tag RG80784-ACR
EEF1G cDNA ORF Clone, Rat, N-OFPSpark® tag RG80784-ANR
EEF1G cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80784-CF
EEF1G cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80784-NF
EEF1G cDNA ORF Clone, Rat, C-His tag RG80784-CH
EEF1G cDNA ORF Clone, Rat, N-His tag RG80784-NH
EEF1G cDNA ORF Clone, Rat, C-HA tag RG80784-CY
EEF1G cDNA ORF Clone, Rat, N-HA tag RG80784-NY
EEF1G cDNA ORF Clone, Rat, C-Myc tag RG80784-CM
EEF1G cDNA ORF Clone, Rat, N-Myc tag RG80784-NM
EEF1G qPCR Primer Pairs, Rat RP300748

EEF1G cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EEF1G cDNA ORF Clone in Cloning Vector, Mouse MG51435-U
EEF1G cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51435-ACG
EEF1G Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51435-ACGLN
EEF1G cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51435-ANG
EEF1G cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51435-ACR
EEF1G cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51435-ANR
EEF1G cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51435-CF
EEF1G cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51435-NF
EEF1G cDNA ORF Clone, Mouse, C-His tag MG51435-CH
EEF1G cDNA ORF Clone, Mouse, N-His tag MG51435-NH
EEF1G cDNA ORF Clone, Mouse, C-HA tag MG51435-CY
EEF1G cDNA ORF Clone, Mouse, N-HA tag MG51435-NY
EEF1G cDNA ORF Clone, Mouse, C-Myc tag MG51435-CM
EEF1G cDNA ORF Clone, Mouse, N-Myc tag MG51435-NM
EEF1G qPCR Primer Pairs, Mouse MP201319

EEF1G cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EEF1G cDNA ORF Clone in Cloning Vector, Human HG14092-G
EEF1G cDNA ORF Clone, Human, untagged HG14092-UT
EEF1G cDNA ORF Clone, Human, C-GFPSpark® tag HG14092-ACG
EEF1G Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14092-ACGLN
EEF1G cDNA ORF Clone, Human, N-GFPSpark® tag HG14092-ANG
EEF1G cDNA ORF Clone, Human, C-OFPSpark® tag HG14092-ACR
EEF1G cDNA ORF Clone, Human, N-OFPSpark® tag HG14092-ANR
EEF1G cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14092-CF
EEF1G cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14092-NF
EEF1G cDNA ORF Clone, Human, C-His tag HG14092-CH
EEF1G cDNA ORF Clone, Human, N-His tag HG14092-NH
EEF1G cDNA ORF Clone, Human, C-HA tag HG14092-CY
EEF1G cDNA ORF Clone, Human, N-HA tag HG14092-NY
EEF1G cDNA ORF Clone, Human, C-Myc tag HG14092-CM
EEF1G cDNA ORF Clone, Human, N-Myc tag HG14092-NM
EEF1G qPCR Primer Pairs, Human HP102745
info info
添加购物车成功! 添加购物车失败!