Quick Order

Mouse EEF1G Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse EEF1G cDNA Clone Product Information
NCBI RefSeq:NM_175074.2
RefSeq ORF Size:1314 bp
cDNA Description:Full length Clone DNA of Mus musculus eukaryotic translation elongation factor 1 gamma
Gene Synonym:2610301D06Rik,AA407312,EF1G
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG51435-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"