EEF1D cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52937-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EEF1D Reagents
CRO Services
Product recommended

All EEF1D Reagents
EEF1D cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Mouse eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEF1D cDNA ORF Clone, Mouse, N-HA tag Alternative Names
EF-1-delta cDNA ORF Clone, Mouse
EEF1D Background Information
Full Name
eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)

EEF1D cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EEF1D cDNA ORF Clone in Cloning Vector, Rat RG87044-U
EEF1D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87044-ACGLN

EEF1D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EEF1D cDNA ORF Clone in Cloning Vector, Mouse MG52937-G
EEF1D cDNA ORF Clone, Mouse, untagged MG52937-UT
EEF1D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52937-ACGLN
EEF1D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52937-ACG
EEF1D cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52937-ANG
EEF1D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52937-ACR
EEF1D cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52937-ANR
EEF1D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52937-CF
EEF1D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52937-NF
EEF1D cDNA ORF Clone, Mouse, C-His tag MG52937-CH
EEF1D cDNA ORF Clone, Mouse, N-His tag MG52937-NH
EEF1D cDNA ORF Clone, Mouse, C-HA tag MG52937-CY
EEF1D cDNA ORF Clone, Mouse, C-Myc tag MG52937-CM
EEF1D cDNA ORF Clone, Mouse, N-Myc tag MG52937-NM

EEF1D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EEF1D cDNA ORF Clone in Cloning Vector, Human HG15299-G
EEF1D cDNA ORF Clone, Human, untagged HG15299-UT
EEF1D cDNA ORF Clone, Human, C-GFPSpark® tag HG15299-ACG
EEF1D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15299-ACGLN
EEF1D cDNA ORF Clone, Human, N-GFPSpark® tag HG15299-ANG
EEF1D cDNA ORF Clone, Human, C-OFPSpark® tag HG15299-ACR
EEF1D cDNA ORF Clone, Human, N-OFPSpark® tag HG15299-ANR
EEF1D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15299-CF
EEF1D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15299-NF
EEF1D cDNA ORF Clone, Human, C-His tag HG15299-CH
EEF1D cDNA ORF Clone, Human, N-His tag HG15299-NH
EEF1D cDNA ORF Clone, Human, C-HA tag HG15299-CY
EEF1D cDNA ORF Clone, Human, N-HA tag HG15299-NY
EEF1D cDNA ORF Clone, Human, C-Myc tag HG15299-CM
EEF1D cDNA ORF Clone, Human, N-Myc tag HG15299-NM
EEF1D qPCR Primer Pairs, Human HP103925
info info
添加购物车成功! 添加购物车失败!