After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EDA2R transcript variant 2 natural ORF mammalian expression plasmid

Datasheet Reviews Related Products Protocols
Mouse EDA2R cDNA Clone Product Information
NCBI RefSeq:NM_175540.5
RefSeq ORF Size:894bp
cDNA Description:Full length Clone DNA of Mus musculus ectodysplasin A2 receptor transcript variant 2.
Gene Synonym:Xedar, TNFRSF27, MGC124099, 9430060M22Rik, Eda2r
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and TNFRSF27, is a single-pass type I II membrane protein. TNFRSF27 / EDA2R contains three TNFR-Cys repeats. It is a new member of the tumor necrosis factor receptor family that has been shown to be highly expressed in ectodermal derivatives during embryonic development and binds to ectodysplasin-A2 (EDA-A2). TNFRSF27 / EDA2R is a receptor for EDA isoform A2, but not for EDA isoform A1. TNFRSF27 / EDA2R mediates the activation of the NF-kappa-B and JNK pathways. The activation seems to be mediated by binding to TRAF3 and TRAF6. Ectodysplasin, a member of the tumor necrosis factor family, is encoded by the anhidrotic ectodermal dysplasia EDA gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that differ only by an insertion of two amino acids. This insertion functions to determine receptor binding specificity, such that EDA-A1 binds only the receptor EDAR, whereas EDA-A2 binds only the related, but distinct, X-linked ectodysplasin-A2 receptor (XEDAR).

References
  • Yan M., et al., 2000,Science. 290: 523-527.
  • Sinha S.K., et al., 2002, J. Biol. Chem. 277: 44953-44961.
  • Prodi, D.A. et al., 2008, J Invest Dermatol  128 (9):2268-70.
  • Size / Price
    Catalog:  MG50411-UT
    List Price:    (Save )
    Price:       [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"