Quick Order

Text Size:AAA

Mouse ECSIT Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse ECSIT cDNA Clone Product Information
NCBI RefSeq:NM_012029.2
RefSeq ORF Size:1308bp
cDNA Description:Full length Clone DNA of Mus musculus ECSIT homolog (Drosophila) with N terminal HA tag.
Gene Synonym:Sitpec
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ECSIT is an adapter protein of the toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Activation of NF-kappaB as a consequence of signaling through the Toll and IL-1 receptors is a major element of innate immune responses. ECSIT is specific for the Toll/IL-1 pathways and is a regulator of MEKK-1 processing. It bridges TRAF6 to MEKK-1. Expression of wild-type ECSIT accelerates processing of MEKK-1, whereas a dominant-negative fragment of ECSIT blocks MEKK-1 processing and activation of NF-kappaB. ECSIT is also required for normal embryonic development and efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase.

References
  • Kopp E. et al., 1999, Genes Dev. 13 (16): 2059-71.
  • The MGC Project Team. 2004, Genome Res. 14: 2121-7.
  • Vogel RO. et al., 2007, Genes Dev. 21: 615-24.
  • Size / Price
    Catalog: MG52140-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"