Quick Order

Text Size:AAA

Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse DYNC1LI1 cDNA Clone Product Information
    NCBI RefSeq:NM_146229.2
    RefSeq ORF Size:1572bp
    cDNA Description:Full length Clone DNA of Mus musculus dynein cytoplasmic 1 light intermediate chain 1 with N terminal Myc tag.
    Gene Synonym:LIC-1, Dnclic1, 1110053F02Rik
    Species:Mouse
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DYNC1LI1 qPCR primers for gene expression analysis, MP202586 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-Myc tag on other vectors
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52715-ACG$245
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52715-ACR$245
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52715-ANG$245
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52715-ANR$245
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG52715-CF$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, C-His tagMG52715-CH$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG52715-CM$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG52715-CY$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone in cloning vectorMG52715-G$75
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG52715-NF$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-His tagMG52715-NH$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG52715-NM$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG52715-NY$215
    Mouse Cytoplasmic dynein 1 light intermediate chain 1 Gene ORF cDNA clone expression plasmidMG52715-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: MG52715-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"