DUSP1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52169-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DUSP1 Reagents
CRO Services
Product recommended

All DUSP1 Reagents
DUSP1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1104 bp
Description
Full length Clone DNA of Mouse dual specificity phosphatase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DUSP1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
3CH134 cDNA ORF Clone, Mouse;erp cDNA ORF Clone, Mouse;mkp-1 cDNA ORF Clone, Mouse;MKP1 cDNA ORF Clone, Mouse;Ptpn16 cDNA ORF Clone, Mouse;U19515 cDNA ORF Clone, Mouse
DUSP1 Background Information
Full Name
dual specificity phosphatase 1

DUSP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DUSP1 cDNA ORF Clone in Cloning Vector, Mouse MG52169-G
DUSP1 cDNA ORF Clone, Mouse, untagged MG52169-UT
DUSP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52169-ACG
DUSP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52169-ACGLN
DUSP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52169-ANG
DUSP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52169-ACR
DUSP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52169-ANR
DUSP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52169-CF
DUSP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52169-NF
DUSP1 cDNA ORF Clone, Mouse, C-His tag MG52169-CH
DUSP1 cDNA ORF Clone, Mouse, N-His tag MG52169-NH
DUSP1 cDNA ORF Clone, Mouse, C-HA tag MG52169-CY
DUSP1 cDNA ORF Clone, Mouse, C-Myc tag MG52169-CM
DUSP1 cDNA ORF Clone, Mouse, N-Myc tag MG52169-NM
DUSP1 qPCR Primer Pairs, Mouse MP202042

DUSP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DUSP1 cDNA ORF Clone in Cloning Vector, Human HG17701-U
DUSP1 cDNA ORF Clone, Human, untagged HG17701-UT
DUSP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17701-ACG
DUSP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17701-ACGLN
DUSP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17701-ANG
DUSP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17701-ACR
DUSP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17701-ANR
DUSP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17701-CF
DUSP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17701-NF
DUSP1 cDNA ORF Clone, Human, C-His tag HG17701-CH
DUSP1 cDNA ORF Clone, Human, N-His tag HG17701-NH
DUSP1 cDNA ORF Clone, Human, C-HA tag HG17701-CY
DUSP1 cDNA ORF Clone, Human, N-HA tag HG17701-NY
DUSP1 cDNA ORF Clone, Human, C-Myc tag HG17701-CM
DUSP1 cDNA ORF Clone, Human, N-Myc tag HG17701-NM
info info
添加购物车成功! 添加购物车失败!