Text Size:AAA

Mouse OVCA1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse DPH1 cDNA Clone Product Information
    NCBI RefSeq:NM_144491.2
    RefSeq ORF Size:1317bp
    cDNA Description:Full length Clone DNA of Mus musculus DPH1 homolog (S. cerevisiae) with C terminal GFPSpark tag.
    Gene Synonym:Ovca1, Dph2l1, AW551873, 2310011M22Rik, 4930488F09Rik
    Species:Mouse
    Vector:pCMV3-C-GFPSpark
    Plasmid:
    Restriction Site:
    Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    GFPSpark Tag Info

    GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

    Product nameProduct name
    Size / Price
    Catalog: MG52776-ACG
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"