aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-His tag

Cat: MG52929-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All aspartyl aminopeptidase Reagents
CRO Services
Product recommended

All aspartyl aminopeptidase Reagents
aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Mouse aspartyl aminopeptidase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-His tag Alternative Names
AA407814 cDNA ORF Clone, Mouse
aspartyl aminopeptidase Background Information
Full Name
aspartyl aminopeptidase

aspartyl aminopeptidase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
aspartyl aminopeptidase cDNA ORF Clone in Cloning Vector, Rat RG81005-U
aspartyl aminopeptidase cDNA ORF Clone, Rat, untagged RG81005-UT
aspartyl aminopeptidase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81005-ACG
aspartyl aminopeptidase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81005-ACGLN
aspartyl aminopeptidase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81005-ANG
aspartyl aminopeptidase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81005-ACR
aspartyl aminopeptidase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81005-ANR
aspartyl aminopeptidase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81005-CF
aspartyl aminopeptidase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81005-NF
aspartyl aminopeptidase cDNA ORF Clone, Rat, C-His tag RG81005-CH
aspartyl aminopeptidase cDNA ORF Clone, Rat, N-His tag RG81005-NH
aspartyl aminopeptidase cDNA ORF Clone, Rat, C-HA tag RG81005-CY
aspartyl aminopeptidase cDNA ORF Clone, Rat, N-HA tag RG81005-NY
aspartyl aminopeptidase cDNA ORF Clone, Rat, C-Myc tag RG81005-CM
aspartyl aminopeptidase cDNA ORF Clone, Rat, N-Myc tag RG81005-NM
aspartyl aminopeptidase qPCR Primer Pairs, Rat RP300969

aspartyl aminopeptidase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
aspartyl aminopeptidase cDNA ORF Clone in Cloning Vector, Mouse MG52929-G
aspartyl aminopeptidase cDNA ORF Clone, Mouse, untagged MG52929-UT
aspartyl aminopeptidase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52929-ACG
aspartyl aminopeptidase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52929-ACGLN
aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52929-ANG
aspartyl aminopeptidase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52929-ACR
aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52929-ANR
aspartyl aminopeptidase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52929-CF
aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52929-NF
aspartyl aminopeptidase cDNA ORF Clone, Mouse, C-His tag MG52929-CH
aspartyl aminopeptidase cDNA ORF Clone, Mouse, C-HA tag MG52929-CY
aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-HA tag MG52929-NY
aspartyl aminopeptidase cDNA ORF Clone, Mouse, C-Myc tag MG52929-CM
aspartyl aminopeptidase cDNA ORF Clone, Mouse, N-Myc tag MG52929-NM

aspartyl aminopeptidase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
aspartyl aminopeptidase cDNA ORF Clone in Cloning Vector, Human HG14276-G
aspartyl aminopeptidase cDNA ORF Clone, Human, untagged HG14276-UT
aspartyl aminopeptidase cDNA ORF Clone, Human, C-GFPSpark® tag HG14276-ACG
aspartyl aminopeptidase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14276-ACGLN
aspartyl aminopeptidase cDNA ORF Clone, Human, N-GFPSpark® tag HG14276-ANG
aspartyl aminopeptidase cDNA ORF Clone, Human, C-OFPSpark® tag HG14276-ACR
aspartyl aminopeptidase cDNA ORF Clone, Human, N-OFPSpark® tag HG14276-ANR
aspartyl aminopeptidase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14276-CF
aspartyl aminopeptidase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14276-NF
aspartyl aminopeptidase cDNA ORF Clone, Human, C-His tag HG14276-CH
aspartyl aminopeptidase cDNA ORF Clone, Human, N-His tag HG14276-NH
aspartyl aminopeptidase cDNA ORF Clone, Human, C-HA tag HG14276-CY
aspartyl aminopeptidase cDNA ORF Clone, Human, N-HA tag HG14276-NY
aspartyl aminopeptidase cDNA ORF Clone, Human, C-Myc tag HG14276-CM
aspartyl aminopeptidase cDNA ORF Clone, Human, N-Myc tag HG14276-NM
aspartyl aminopeptidase qPCR Primer Pairs, Human HP102926
info info
添加购物车成功! 添加购物车失败!