DNAJC9 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51519-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DNAJC9 Reagents
CRO Services
Product recommended

All DNAJC9 Reagents
DNAJC9 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
780 bp
Description
Full length Clone DNA of Mouse DnaJ (Hsp40) homolog, subfamily C, member 9 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNAJC9 cDNA ORF Clone, Mouse, N-His tag Alternative Names
5330419I01Rik cDNA ORF Clone, Mouse;AU020082 cDNA ORF Clone, Mouse
DNAJC9 Background Information
Full Name
DnaJ (Hsp40) homolog, subfamily C, member 9

DNAJC9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DNAJC9 cDNA ORF Clone in Cloning Vector, Mouse MG51519-U
DNAJC9 cDNA ORF Clone, Mouse, untagged MG51519-UT
DNAJC9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51519-ACGLN
DNAJC9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51519-ACG
DNAJC9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51519-ANG
DNAJC9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51519-ACR
DNAJC9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51519-ANR
DNAJC9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51519-CF
DNAJC9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51519-NF
DNAJC9 cDNA ORF Clone, Mouse, C-His tag MG51519-CH
DNAJC9 cDNA ORF Clone, Mouse, C-HA tag MG51519-CY
DNAJC9 cDNA ORF Clone, Mouse, N-HA tag MG51519-NY
DNAJC9 cDNA ORF Clone, Mouse, C-Myc tag MG51519-CM
DNAJC9 cDNA ORF Clone, Mouse, N-Myc tag MG51519-NM
DNAJC9 qPCR Primer Pairs, Mouse MP201403

DNAJC9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DNAJC9 cDNA ORF Clone in Cloning Vector, Human HG22216-U
DNAJC9 cDNA ORF Clone, Human, untagged HG22216-UT
DNAJC9 cDNA ORF Clone, Human, C-GFPSpark® tag HG22216-ACG
DNAJC9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22216-ACGLN
DNAJC9 cDNA ORF Clone, Human, N-GFPSpark® tag HG22216-ANG
DNAJC9 cDNA ORF Clone, Human, C-OFPSpark® tag HG22216-ACR
DNAJC9 cDNA ORF Clone, Human, N-OFPSpark® tag HG22216-ANR
DNAJC9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22216-CF
DNAJC9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22216-NF
DNAJC9 cDNA ORF Clone, Human, C-His tag HG22216-CH
DNAJC9 cDNA ORF Clone, Human, N-His tag HG22216-NH
DNAJC9 cDNA ORF Clone, Human, C-HA tag HG22216-CY
DNAJC9 cDNA ORF Clone, Human, N-HA tag HG22216-NY
DNAJC9 cDNA ORF Clone, Human, C-Myc tag HG22216-CM
DNAJC9 cDNA ORF Clone, Human, N-Myc tag HG22216-NM
info info
添加购物车成功! 添加购物车失败!