TID1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51440-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TID1 Reagents
CRO Services
Product recommended

All TID1 Reagents
TID1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1443 bp
Description
Full length Clone DNA of Mouse DnaJ (Hsp40) homolog, subfamily A, member 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TID1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1200003J13Rik cDNA ORF Clone, Mouse;1810053A11Rik cDNA ORF Clone, Mouse;C81173 cDNA ORF Clone, Mouse;Tid-1 cDNA ORF Clone, Mouse;Tid1l cDNA ORF Clone, Mouse
TID1 Background Information
Full Name
DnaJ heat shock protein family (Hsp40) member A3

TID1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TID1 cDNA ORF Clone in Cloning Vector, Mouse MG51440-G
TID1 cDNA ORF Clone in Cloning Vector, Mouse MG5A7566-U
TID1 cDNA ORF Clone, Mouse, untagged MG5A7566-UT
TID1 cDNA ORF Clone, Mouse, untagged MG51440-UT
TID1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51440-ACGLN
TID1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7566-ACGLN
TID1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51440-ACG
TID1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7566-ACG
TID1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51440-ANG
TID1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7566-ANG
TID1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7566-ACR
TID1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51440-ACR
TID1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7566-ANR
TID1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51440-ANR
TID1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7566-CF
TID1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51440-CF
TID1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51440-NF
TID1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7566-NF
TID1 cDNA ORF Clone, Mouse, C-His tag MG5A7566-CH
TID1 cDNA ORF Clone, Mouse, C-His tag MG51440-CH
TID1 cDNA ORF Clone, Mouse, N-His tag MG5A7566-NH
TID1 cDNA ORF Clone, Mouse, C-HA tag MG5A7566-CY
TID1 cDNA ORF Clone, Mouse, C-HA tag MG51440-CY
TID1 cDNA ORF Clone, Mouse, N-HA tag MG51440-NY
TID1 cDNA ORF Clone, Mouse, N-HA tag MG5A7566-NY
TID1 cDNA ORF Clone, Mouse, C-Myc tag MG5A7566-CM
TID1 cDNA ORF Clone, Mouse, C-Myc tag MG51440-CM
TID1 cDNA ORF Clone, Mouse, N-Myc tag MG51440-NM
TID1 cDNA ORF Clone, Mouse, N-Myc tag MG5A7566-NM
TID1 qPCR Primer Pairs, Mouse MP201324

TID1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TID1 cDNA ORF Clone in Cloning Vector, Human HG18767-U
TID1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18767-ACGLN
info info
添加购物车成功! 添加购物车失败!