lipoamide dehydrogenase cDNA ORF Clone, Mouse, untagged

Cat: MG51430-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All lipoamide dehydrogenase Reagents
CRO Services
Product recommended

All lipoamide dehydrogenase Reagents
lipoamide dehydrogenase cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Description
Full length Clone DNA of Mouse dihydrolipoamide dehydrogenase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

lipoamide dehydrogenase Background Information
Full Name
dihydrolipoamide dehydrogenase

lipoamide dehydrogenase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
lipoamide dehydrogenase cDNA ORF Clone in Cloning Vector, Rat RG83564-U
lipoamide dehydrogenase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83564-ACGLN

lipoamide dehydrogenase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
lipoamide dehydrogenase cDNA ORF Clone in Cloning Vector, Mouse MG51430-U
lipoamide dehydrogenase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51430-ACGLN
lipoamide dehydrogenase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51430-ACG
lipoamide dehydrogenase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51430-ANG
lipoamide dehydrogenase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51430-ACR
lipoamide dehydrogenase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51430-ANR
lipoamide dehydrogenase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51430-CF
lipoamide dehydrogenase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51430-NF
lipoamide dehydrogenase cDNA ORF Clone, Mouse, C-His tag MG51430-CH
lipoamide dehydrogenase cDNA ORF Clone, Mouse, N-His tag MG51430-NH
lipoamide dehydrogenase cDNA ORF Clone, Mouse, C-HA tag MG51430-CY
lipoamide dehydrogenase cDNA ORF Clone, Mouse, N-HA tag MG51430-NY
lipoamide dehydrogenase cDNA ORF Clone, Mouse, C-Myc tag MG51430-CM
lipoamide dehydrogenase cDNA ORF Clone, Mouse, N-Myc tag MG51430-NM
lipoamide dehydrogenase qPCR Primer Pairs, Mouse MP201314

lipoamide dehydrogenase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
lipoamide dehydrogenase cDNA ORF Clone in Cloning Vector, Human HG15479-G
lipoamide dehydrogenase cDNA ORF Clone, Human, untagged HG15479-UT
lipoamide dehydrogenase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15479-ACGLN
lipoamide dehydrogenase cDNA ORF Clone, Human, C-GFPSpark® tag HG15479-ACG
lipoamide dehydrogenase cDNA ORF Clone, Human, N-GFPSpark® tag HG15479-ANG
lipoamide dehydrogenase cDNA ORF Clone, Human, C-OFPSpark® tag HG15479-ACR
lipoamide dehydrogenase cDNA ORF Clone, Human, N-OFPSpark® tag HG15479-ANR
lipoamide dehydrogenase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15479-CF
lipoamide dehydrogenase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15479-NF
lipoamide dehydrogenase cDNA ORF Clone, Human, C-His tag HG15479-CH
lipoamide dehydrogenase cDNA ORF Clone, Human, N-His tag HG15479-NH
lipoamide dehydrogenase cDNA ORF Clone, Human, C-HA tag HG15479-CY
lipoamide dehydrogenase cDNA ORF Clone, Human, N-HA tag HG15479-NY
lipoamide dehydrogenase cDNA ORF Clone, Human, C-Myc tag HG15479-CM
lipoamide dehydrogenase cDNA ORF Clone, Human, N-Myc tag HG15479-NM
lipoamide dehydrogenase qPCR Primer Pairs, Human HP104101
info info
添加购物车成功! 添加购物车失败!