Quick Order

Mouse DKK3 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse DKK3 cDNA Clone Product Information
NCBI RefSeq:NM_015814.2
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Mus musculus dickkopf homolog 3 (Xenopus laevis) with N terminal His tag.
Gene Synonym:C87148, AW061014, Dkk3
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

DKK3 (dickkopf related protein 3) is a member of the dickkopf-related family consisting of DKK1, DKK2, DKK3 and DKK4. It is a secreted protein, and also known as REIC (Reduced Expansion in Immortalized Cells). The DKK3 protein is proposed to function as a secreted tumor suppressor since it is downregulated in a number of cancer cells and prostate cancer tissue and may be a promising candidate molecule for therapeutic interference. DKK3 protein is also a negative regulator of beta-catenin and its downregulation contribute to an activation of the beta-catenin signaling pathway.

References
  • Yue W, et al., 2008. Downregulation of Dkk3 activates beta-catenin/TCF-4 signaling in lung cancer. Carcinogenesis, 29 (1): 84-92.
  • Ding Z, et al., 2009. Promoter methylation and mRNA expression of DKK3 and WIF-1 in hepatocellular carcinoma. World J Gastroenterol, 15 (21):2595-601.
  • Size / Price
    Catalog: MG50247-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"