DHRS1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52284-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DHRS1 Reagents
CRO Services
Product recommended

All DHRS1 Reagents
DHRS1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Mouse dehydrogenase/reductase (SDR family) member 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DHRS1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1110029G07Rik cDNA ORF Clone, Mouse;AW112170 cDNA ORF Clone, Mouse;D14Ertd484e cDNA ORF Clone, Mouse
DHRS1 Background Information
Full Name
dehydrogenase/reductase (SDR family) member 1

DHRS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DHRS1 cDNA ORF Clone in Cloning Vector, Mouse MG52284-G
DHRS1 cDNA ORF Clone, Mouse, untagged MG52284-UT
DHRS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52284-ACG
DHRS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52284-ACGLN
DHRS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52284-ANG
DHRS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52284-ACR
DHRS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52284-ANR
DHRS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52284-CF
DHRS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52284-NF
DHRS1 cDNA ORF Clone, Mouse, C-His tag MG52284-CH
DHRS1 cDNA ORF Clone, Mouse, N-His tag MG52284-NH
DHRS1 cDNA ORF Clone, Mouse, C-HA tag MG52284-CY
DHRS1 cDNA ORF Clone, Mouse, C-Myc tag MG52284-CM
DHRS1 cDNA ORF Clone, Mouse, N-Myc tag MG52284-NM
DHRS1 qPCR Primer Pairs, Mouse MP202157

DHRS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DHRS1 cDNA ORF Clone in Cloning Vector, Human HG14100-G
DHRS1 cDNA ORF Clone, Human, untagged HG14100-UT
DHRS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14100-ACG
DHRS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14100-ACGLN
DHRS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14100-ANG
DHRS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14100-ACR
DHRS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14100-ANR
DHRS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14100-CF
DHRS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14100-NF
DHRS1 cDNA ORF Clone, Human, C-His tag HG14100-CH
DHRS1 cDNA ORF Clone, Human, N-His tag HG14100-NH
DHRS1 cDNA ORF Clone, Human, C-HA tag HG14100-CY
DHRS1 cDNA ORF Clone, Human, N-HA tag HG14100-NY
DHRS1 cDNA ORF Clone, Human, C-Myc tag HG14100-CM
DHRS1 cDNA ORF Clone, Human, N-Myc tag HG14100-NM
DHRS1 qPCR Primer Pairs, Human HP102753
info info
添加购物车成功! 添加购物车失败!