Derlin-1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52801-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Derlin-1 Reagents
CRO Services
Product recommended

All Derlin-1 Reagents
Derlin-1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
756 bp
Description
Full length Clone DNA of Mouse Der1-like domain family, member 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Derlin-1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110021N07Rik cDNA ORF Clone, Mouse;AI195141 cDNA ORF Clone, Mouse;AW551338 cDNA ORF Clone, Mouse;Derlin-1 cDNA ORF Clone, Mouse
Derlin-1 Background Information
Full Name
derlin 1

Derlin-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Derlin-1 cDNA ORF Clone in Cloning Vector, Mouse MG52801-G
Derlin-1 cDNA ORF Clone, Mouse, untagged MG52801-UT
Derlin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52801-ACGLN
Derlin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52801-ACG
Derlin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52801-ACR
Derlin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52801-CF
Derlin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52801-NF
Derlin-1 cDNA ORF Clone, Mouse, C-His tag MG52801-CH
Derlin-1 cDNA ORF Clone, Mouse, N-His tag MG52801-NH
Derlin-1 cDNA ORF Clone, Mouse, C-HA tag MG52801-CY
Derlin-1 cDNA ORF Clone, Mouse, N-HA tag MG52801-NY
Derlin-1 cDNA ORF Clone, Mouse, N-Myc tag MG52801-NM

Derlin-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Derlin-1 cDNA ORF Clone in Cloning Vector, Human HG18986-U
Derlin-1 cDNA ORF Clone, Human, untagged HG18986-UT
Derlin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18986-ACGLN
Derlin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18986-ACG
Derlin-1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18986-ANG
Derlin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18986-ACR
Derlin-1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18986-ANR
Derlin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18986-CF
Derlin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18986-NF
Derlin-1 cDNA ORF Clone, Human, C-His tag HG18986-CH
Derlin-1 cDNA ORF Clone, Human, N-His tag HG18986-NH
Derlin-1 cDNA ORF Clone, Human, C-HA tag HG18986-CY
Derlin-1 cDNA ORF Clone, Human, N-HA tag HG18986-NY
Derlin-1 cDNA ORF Clone, Human, C-Myc tag HG18986-CM
Derlin-1 cDNA ORF Clone, Human, N-Myc tag HG18986-NM
info info
添加购物车成功! 添加购物车失败!