DDX47 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51748-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DDX47 Reagents
CRO Services
Product recommended

All DDX47 Reagents
DDX47 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1368 bp
Description
Full length Clone DNA of Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX47 cDNA ORF Clone, Mouse, C-His tag Alternative Names
4930588A18Rik cDNA ORF Clone, Mouse;C77285 cDNA ORF Clone, Mouse
DDX47 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47

DDX47 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDX47 cDNA ORF Clone in Cloning Vector, Mouse MG51748-G
DDX47 cDNA ORF Clone, Mouse, untagged MG51748-UT
DDX47 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51748-ACGLN
DDX47 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51748-ACG
DDX47 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51748-ANG
DDX47 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51748-ACR
DDX47 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51748-ANR
DDX47 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51748-CF
DDX47 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51748-NF
DDX47 cDNA ORF Clone, Mouse, N-His tag MG51748-NH
DDX47 cDNA ORF Clone, Mouse, C-HA tag MG51748-CY
DDX47 cDNA ORF Clone, Mouse, N-HA tag MG51748-NY
DDX47 cDNA ORF Clone, Mouse, C-Myc tag MG51748-CM
DDX47 cDNA ORF Clone, Mouse, N-Myc tag MG51748-NM
DDX47 qPCR Primer Pairs, Mouse MP201621

DDX47 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX47 cDNA ORF Clone in Cloning Vector, Human HG21882-U
DDX47 cDNA ORF Clone, Human, untagged HG21882-UT
DDX47 cDNA ORF Clone, Human, C-GFPSpark® tag HG21882-ACG
DDX47 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21882-ACGLN
DDX47 cDNA ORF Clone, Human, N-GFPSpark® tag HG21882-ANG
DDX47 cDNA ORF Clone, Human, C-OFPSpark® tag HG21882-ACR
DDX47 cDNA ORF Clone, Human, N-OFPSpark® tag HG21882-ANR
DDX47 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21882-CF
DDX47 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21882-NF
DDX47 cDNA ORF Clone, Human, C-His tag HG21882-CH
DDX47 cDNA ORF Clone, Human, N-His tag HG21882-NH
DDX47 cDNA ORF Clone, Human, C-HA tag HG21882-CY
DDX47 cDNA ORF Clone, Human, N-HA tag HG21882-NY
DDX47 cDNA ORF Clone, Human, C-Myc tag HG21882-CM
DDX47 cDNA ORF Clone, Human, N-Myc tag HG21882-NM
info info
添加购物车成功! 添加购物车失败!