UAP56 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51218-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UAP56 Reagents
CRO Services
Product recommended

All UAP56 Reagents
UAP56 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1287 bp
Description
Full length Clone DNA of Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UAP56 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
0610030D10Rik cDNA ORF Clone, Mouse;AI428441 cDNA ORF Clone, Mouse;Bat-1 cDNA ORF Clone, Mouse;Bat1 cDNA ORF Clone, Mouse;Bat1a cDNA ORF Clone, Mouse;D17H6S81E cDNA ORF Clone, Mouse;D17H6S81E-1 cDNA ORF Clone, Mouse;D6S81Eh cDNA ORF Clone, Mouse
UAP56 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B

UAP56 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UAP56 cDNA ORF Clone in Cloning Vector, Mouse MG51218-U
UAP56 cDNA ORF Clone, Mouse, untagged MG51218-UT
UAP56 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51218-ACG
UAP56 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51218-ACGLN
UAP56 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51218-ANG
UAP56 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51218-ACR
UAP56 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51218-ANR
UAP56 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51218-CF
UAP56 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51218-NF
UAP56 cDNA ORF Clone, Mouse, C-His tag MG51218-CH
UAP56 cDNA ORF Clone, Mouse, N-His tag MG51218-NH
UAP56 cDNA ORF Clone, Mouse, N-HA tag MG51218-NY
UAP56 cDNA ORF Clone, Mouse, C-Myc tag MG51218-CM
UAP56 cDNA ORF Clone, Mouse, N-Myc tag MG51218-NM
UAP56 qPCR Primer Pairs, Mouse MP201102

UAP56 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UAP56 cDNA ORF Clone in Cloning Vector, Human HG16299-G
UAP56 cDNA ORF Clone, Human, untagged HG16299-UT
UAP56 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16299-ACGLN
UAP56 cDNA ORF Clone, Human, C-GFPSpark® tag HG16299-ACG
UAP56 cDNA ORF Clone, Human, N-GFPSpark® tag HG16299-ANG
UAP56 cDNA ORF Clone, Human, C-OFPSpark® tag HG16299-ACR
UAP56 cDNA ORF Clone, Human, N-OFPSpark® tag HG16299-ANR
UAP56 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16299-CF
UAP56 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16299-NF
UAP56 cDNA ORF Clone, Human, C-His tag HG16299-CH
UAP56 cDNA ORF Clone, Human, N-His tag HG16299-NH
UAP56 cDNA ORF Clone, Human, C-HA tag HG16299-CY
UAP56 cDNA ORF Clone, Human, N-HA tag HG16299-NY
UAP56 cDNA ORF Clone, Human, C-Myc tag HG16299-CM
UAP56 cDNA ORF Clone, Human, N-Myc tag HG16299-NM
UAP56 qPCR Primer Pairs, Human HP105053
info info
添加购物车成功! 添加购物车失败!