MDDX28/DDX28 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52391-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MDDX28/DDX28 Reagents
CRO Services
Product recommended

All MDDX28/DDX28 Reagents
MDDX28/DDX28 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1623 bp
Description
Full length Clone DNA of Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MDDX28/DDX28 cDNA ORF Clone, Mouse, C-His tag Alternative Names
2410004K13Rik cDNA ORF Clone, Mouse;AI449652 cDNA ORF Clone, Mouse;Mddx28 cDNA ORF Clone, Mouse
MDDX28/DDX28 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28

MDDX28/DDX28 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MDDX28/DDX28 cDNA ORF Clone in Cloning Vector, Mouse MG52391-G
MDDX28/DDX28 cDNA ORF Clone, Mouse, untagged MG52391-UT
MDDX28/DDX28 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52391-ACG
MDDX28/DDX28 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52391-ACGLN
MDDX28/DDX28 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52391-ANG
MDDX28/DDX28 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52391-ACR
MDDX28/DDX28 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52391-ANR
MDDX28/DDX28 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52391-CF
MDDX28/DDX28 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52391-NF
MDDX28/DDX28 cDNA ORF Clone, Mouse, N-His tag MG52391-NH
MDDX28/DDX28 cDNA ORF Clone, Mouse, C-HA tag MG52391-CY
MDDX28/DDX28 cDNA ORF Clone, Mouse, N-HA tag MG52391-NY
MDDX28/DDX28 cDNA ORF Clone, Mouse, C-Myc tag MG52391-CM
MDDX28/DDX28 cDNA ORF Clone, Mouse, N-Myc tag MG52391-NM
MDDX28/DDX28 qPCR Primer Pairs, Mouse MP202264

MDDX28/DDX28 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MDDX28/DDX28 cDNA ORF Clone in Cloning Vector, Human HG17119-U
MDDX28/DDX28 cDNA ORF Clone, Human, untagged HG17119-UT
MDDX28/DDX28 cDNA ORF Clone, Human, C-GFPSpark® tag HG17119-ACG
MDDX28/DDX28 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17119-ACGLN
MDDX28/DDX28 cDNA ORF Clone, Human, N-GFPSpark® tag HG17119-ANG
MDDX28/DDX28 cDNA ORF Clone, Human, C-OFPSpark® tag HG17119-ACR
MDDX28/DDX28 cDNA ORF Clone, Human, N-OFPSpark® tag HG17119-ANR
MDDX28/DDX28 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17119-CF
MDDX28/DDX28 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17119-NF
MDDX28/DDX28 cDNA ORF Clone, Human, C-His tag HG17119-CH
MDDX28/DDX28 cDNA ORF Clone, Human, N-His tag HG17119-NH
MDDX28/DDX28 cDNA ORF Clone, Human, C-HA tag HG17119-CY
MDDX28/DDX28 cDNA ORF Clone, Human, N-HA tag HG17119-NY
MDDX28/DDX28 cDNA ORF Clone, Human, C-Myc tag HG17119-CM
MDDX28/DDX28 cDNA ORF Clone, Human, N-Myc tag HG17119-NM
info info
添加购物车成功! 添加购物车失败!