DDX24 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53015-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DDX24 Reagents
CRO Services
Product recommended

All DDX24 Reagents
DDX24 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2574 bp
Description
Full length Clone DNA of Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX24 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1700055J08Rik cDNA ORF Clone, Mouse;2510027P10Rik cDNA ORF Clone, Mouse;AI649272 cDNA ORF Clone, Mouse
DDX24 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box helicase 24

DDX24 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDX24 cDNA ORF Clone in Cloning Vector, Mouse MG53015-G
DDX24 cDNA ORF Clone, Mouse, untagged MG53015-UT
DDX24 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53015-ACG
DDX24 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53015-ACGLN
DDX24 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53015-ANG
DDX24 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53015-ACR
DDX24 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53015-ANR
DDX24 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53015-CF
DDX24 cDNA ORF Clone, Mouse, C-His tag MG53015-CH
DDX24 cDNA ORF Clone, Mouse, N-His tag MG53015-NH
DDX24 cDNA ORF Clone, Mouse, C-HA tag MG53015-CY
DDX24 cDNA ORF Clone, Mouse, N-HA tag MG53015-NY
DDX24 cDNA ORF Clone, Mouse, C-Myc tag MG53015-CM
DDX24 cDNA ORF Clone, Mouse, N-Myc tag MG53015-NM

DDX24 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX24 cDNA ORF Clone in Cloning Vector, Human HG16607-U
DDX24 cDNA ORF Clone, Human, untagged HG16607-UT
DDX24 cDNA ORF Clone, Human, C-GFPSpark® tag HG16607-ACG
DDX24 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16607-ACGLN
DDX24 cDNA ORF Clone, Human, N-GFPSpark® tag HG16607-ANG
DDX24 cDNA ORF Clone, Human, C-OFPSpark® tag HG16607-ACR
DDX24 cDNA ORF Clone, Human, N-OFPSpark® tag HG16607-ANR
DDX24 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16607-CF
DDX24 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16607-NF
DDX24 cDNA ORF Clone, Human, C-His tag HG16607-CH
DDX24 cDNA ORF Clone, Human, N-His tag HG16607-NH
DDX24 cDNA ORF Clone, Human, C-HA tag HG16607-CY
DDX24 cDNA ORF Clone, Human, N-HA tag HG16607-NY
DDX24 cDNA ORF Clone, Human, C-Myc tag HG16607-CM
DDX24 cDNA ORF Clone, Human, N-Myc tag HG16607-NM
info info
添加购物车成功! 添加购物车失败!