DDR1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50829-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DDR1 Reagents
CRO Services
Product recommended

All DDR1 Reagents
DDR1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2625 bp
Description
Full length Clone DNA of Mouse discoidin domain receptor family, member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDR1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
6030432F18 cDNA ORF Clone, Mouse;AI323681 cDNA ORF Clone, Mouse;Cak cDNA ORF Clone, Mouse;CD167a cDNA ORF Clone, Mouse;Nep cDNA ORF Clone, Mouse;PTK3A cDNA ORF Clone, Mouse
DDR1 Background Information

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 10 (MCK10), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK10/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK10/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.

Full Name
discoidin domain receptor tyrosine kinase 1
References
  • Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.
  • Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.
  • Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.
  • DDR1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DDR1 cDNA ORF Clone in Cloning Vector, Rat RG80440-U

    DDR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DDR1 cDNA ORF Clone in Cloning Vector, Mouse MG50829-G
    DDR1 cDNA ORF Clone, Mouse, untagged MG50829-UT
    DDR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50829-ACGLN
    DDR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50829-ACG
    DDR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50829-ACR
    DDR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50829-CF
    DDR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50829-NF
    DDR1 cDNA ORF Clone, Mouse, C-His tag MG50829-CH
    DDR1 cDNA ORF Clone, Mouse, N-His tag MG50829-NH
    DDR1 cDNA ORF Clone, Mouse, C-HA tag MG50829-CY
    DDR1 cDNA ORF Clone, Mouse, N-HA tag MG50829-NY
    DDR1 cDNA ORF Clone, Mouse, C-Myc tag MG50829-CM
    DDR1 qPCR Primer Pairs, Mouse MP200800

    DDR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DDR1 cDNA ORF Clone in Cloning Vector, Human HG10730-M
    DDR1 cDNA ORF Clone, Human, untagged HG10730-UT
    DDR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10730-ACG
    DDR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10730-ACGLN
    DDR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10730-ACR
    DDR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10730-CF
    DDR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10730-NF
    DDR1 cDNA ORF Clone, Human, C-His tag HG10730-CH
    DDR1 cDNA ORF Clone, Human, N-His tag HG10730-NH
    DDR1 cDNA ORF Clone, Human, C-HA tag HG10730-CY
    DDR1 cDNA ORF Clone, Human, N-HA tag HG10730-NY
    DDR1 cDNA ORF Clone, Human, C-Myc tag HG10730-CM
    DDR1 cDNA ORF Clone, Human, N-Myc tag HG10730-NM
    DDR1 qPCR Primer Pairs, Human HP100668
    info info
    添加购物车成功! 添加购物车失败!