DDOST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52108-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DDOST Reagents
CRO Services
Product recommended

All DDOST Reagents
DDOST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1326 bp
Description
Full length Clone DNA of Mouse dolichyl-di-phosphooligosaccharide-protein glycotransferase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDOST Background Information

The enzyme oligosaccharyltransferase (dolichyl-diphosphooligosaccharide-protein glycosyltransferase) (DDOST), or 48-kDa subunit (OST48) is one of the catalytic subunits in this complex, exerts a typical type I membrane topology, containing a large luminal domain, a hydrophobic transmembrane domain and a short cytosolic peptide tail. DDOST/OST48 catalyzes the transfer of a high-mannose oligosaccharide (GlcNac2Man9Glc3) from a dolichol-linked oligosaccharide donor (dolichol-P-GlcNac2Man9Glc3) onto the asparagine acceptor site within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains across the membrane of the endoplasmic reticulum. The mammalian oligosaccharyltransferase (OST) is an oligomeric complex composed of three type I transmembrane proteins of the endoplasmic reticulum: ribophorin I (RI), ribophorin II (RII), and OST48. OST48 is not a glycoprotein and is not recognized by antibodies to either ribophorin. Like ribophorins I and II, OST48 was found to be an integral membrane protein, with the majority of the polypeptide located within the lumen of the endoplasmic reticulum (ER). OST48 does not show significant amino acid sequence homology to either ribophorin I or II. It had been found that only the luminal domain of RI contains ER retention information. The dilysine motif in OST48 functions as an ER localization motif because OST48 in which the two lysine residues are replaced by serine (OST48ss) is no longer retained in the ER and is found instead also at the plasma membrane.

Full Name
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
References
  • Silberstein S, et al. (1992) The 48-kDa subunit of the mammalian oligosaccharyltransferase complex is homologous to the essential yeast protein WBP1. J Biol Chem. 267(33): 23658-63.
  • Fu J, et al. (1997) Interactions among subunits of the oligosaccharyltransferase complex. J Biol Chem. 272(47): 29687-92.
  • Yamagata T, et al. (1997) Genomics. Genome organization of human 48-kDa oligosaccharyltransferase (DDOST). 45(3): 535-40.
  • Fu J, et al. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J Biol Chem. 275(6): 3984-90.
  • Hardt B, et al. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol Chem. 382(7): 1039-47.
  • DDOST cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DDOST cDNA ORF Clone in Cloning Vector, Rat RG81483-G

    DDOST cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DDOST cDNA ORF Clone in Cloning Vector, Mouse MG52108-G
    DDOST cDNA ORF Clone, Mouse, untagged MG52108-UT
    DDOST cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52108-ACG
    DDOST Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52108-ACGLN
    DDOST cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52108-ACR
    DDOST cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52108-CF
    DDOST cDNA ORF Clone, Mouse, C-His tag MG52108-CH
    DDOST cDNA ORF Clone, Mouse, N-His tag MG52108-NH
    DDOST cDNA ORF Clone, Mouse, C-HA tag MG52108-CY
    DDOST cDNA ORF Clone, Mouse, N-HA tag MG52108-NY
    DDOST cDNA ORF Clone, Mouse, C-Myc tag MG52108-CM
    DDOST cDNA ORF Clone, Mouse, N-Myc tag MG52108-NM
    DDOST qPCR Primer Pairs, Mouse MP201981

    DDOST cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DDOST cDNA ORF Clone in Cloning Vector, Human HG12463-U
    DDOST cDNA ORF Clone, Human, untagged HG12463-UT
    DDOST cDNA ORF Clone, Human, C-GFPSpark® tag HG12463-ACG
    DDOST Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12463-ACGLN
    DDOST cDNA ORF Clone, Human, N-GFPSpark® tag HG12463-ANG
    DDOST cDNA ORF Clone, Human, C-OFPSpark® tag HG12463-ACR
    DDOST cDNA ORF Clone, Human, N-OFPSpark® tag HG12463-ANR
    DDOST cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12463-CF
    DDOST cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12463-NF
    DDOST cDNA ORF Clone, Human, C-His tag HG12463-CH
    DDOST cDNA ORF Clone, Human, N-His tag HG12463-NH
    DDOST cDNA ORF Clone, Human, C-HA tag HG12463-CY
    DDOST cDNA ORF Clone, Human, N-HA tag HG12463-NY
    DDOST cDNA ORF Clone, Human, C-Myc tag HG12463-CM
    DDOST cDNA ORF Clone, Human, N-Myc tag HG12463-NM
    DDOST qPCR Primer Pairs, Human HP104794
    info info
    添加购物车成功! 添加购物车失败!